After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Яванский макак GRM2 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus GRM2 Информация о продукте «Клон cDNA»
Размер кДНК:2619bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) glutamate receptor, metabotropic 2 with N terminal HA tag.
Синоним гена:mGluR2
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Яванский макак GRM2 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Яванский макак GRM2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90427-ACGRBS22240
Яванский макак GRM2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90427-ACRRBS22240
Яванский макак GRM2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90427-CFRBS20190
Яванский макак GRM2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90427-CHRBS20190
Яванский макак GRM2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90427-CMRBS20190
Яванский макак GRM2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90427-CYRBS20190
Яванский макак GRM2 Джин клон кДНК в вектор клонированияCG90427-GRBS5130
Яванский макак GRM2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90427-NFRBS20190
Яванский макак GRM2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90427-NHRBS20190
Яванский макак GRM2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90427-NMRBS20190
Яванский макак GRM2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90427-NYRBS20190
Яванский макак GRM2 Джин ORF экспрессии кДНК клона плазмидыCG90427-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90427-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.