Быстрый заказ

Яванский макак GRM2 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Яванский макак GRM2 Информация о продукте «Клон cDNA»
    Размер кДНК:2619bp
    Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) glutamate receptor, metabotropic 2 with N terminal HA tag.
    Синоним гена:mGluR2
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Яванский макак GRM2 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
    Яванский макак GRM2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90427-ACGRBS22240
    Яванский макак GRM2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90427-ACRRBS22240
    Яванский макак GRM2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90427-CFRBS20190
    Яванский макак GRM2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90427-CHRBS20190
    Яванский макак GRM2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90427-CMRBS20190
    Яванский макак GRM2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90427-CYRBS20190
    Яванский макак GRM2 Джин клон кДНК в вектор клонированияCG90427-GRBS5130
    Яванский макак GRM2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90427-NFRBS20190
    Яванский макак GRM2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90427-NHRBS20190
    Яванский макак GRM2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90427-NMRBS20190
    Яванский макак GRM2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90427-NYRBS20190
    Яванский макак GRM2 Джин ORF экспрессии кДНК клона плазмидыCG90427-UTRBS20190
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: CG90427-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.