After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Яванский макак Aspartate aminotransferase / GOT1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus GOT1 Информация о продукте «Клон cDNA»
Размер кДНК:1242bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) Aspartate aminotransferase, cytoplasmic with N terminal Myc tag.
Синоним гена:cCAT, cAspAT
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Яванский макак Aspartate aminotransferase / GOT1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Яванский макак Aspartate aminotransferase / GOT1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90649-ACGRBS15400
Яванский макак Aspartate aminotransferase / GOT1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90649-ACRRBS15400
Яванский макак Aspartate aminotransferase / GOT1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90649-ANGRBS15400
Яванский макак Aspartate aminotransferase / GOT1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90649-ANRRBS15400
Яванский макак Aspartate aminotransferase / GOT1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90649-CFRBS13340
Яванский макак Aspartate aminotransferase / GOT1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90649-CHRBS13340
Яванский макак Aspartate aminotransferase / GOT1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90649-CMRBS13340
Яванский макак Aspartate aminotransferase / GOT1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90649-CYRBS13340
Яванский макак Aspartate aminotransferase / GOT1 Джин клон кДНК в вектор клонированияCG90649-GRBS5130
Яванский макак Aspartate aminotransferase / GOT1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90649-NFRBS13340
Яванский макак Aspartate aminotransferase / GOT1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90649-NHRBS13340
Яванский макак Aspartate aminotransferase / GOT1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90649-NMRBS13340
Яванский макак Aspartate aminotransferase / GOT1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90649-NYRBS13340
Яванский макак Aspartate aminotransferase / GOT1 Джин ORF экспрессии кДНК клона плазмидыCG90649-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Aspartate aminotransferase is a pyridoxal phosphate-dependent enzyme which exists in cytoplasmic and mitochondrial forms, aspartate aminotransferase and GOT2, respectively. GOT plays a role in amino acid metabolism and the urea and tricarboxylic acid cycles. The two enzymes are homodimeric and show close homology. There is a rare in-frame deletion in aspartate aminotransferase gene, which inactivates cytosolic aspartate aminotransferase(cAST) enzyme in the Old Order Amish. This may help to understand structure and function of the enzyme and would be useful for predicting serum aspartate AST levels.

  • Shen H, et al. (2011) Genome-wide association study identifies genetic variants in GOT1 determining serum aspartate aminotransferase levels. J Hum Genet. 56(11):801-5.
  • Doonan S, et al. (1985) Structural and genetic relationships between cytosolic and mitochondrial isoenzymes. Int J Biochem. 16(12):1193-9.
  • Panteghini M. (1990) Aspartate aminotransferase isoenzymes. Clin Biochem. 23(4):311-9.
  • Bousquet-Lemercier B, et al. (1990) Properties of human liver cytosolic aspartate aminotransferase mRNAs generated by alternative polyadenylation site selection. Biochemistry. 29(22):5293-9.
  • Size / Price
    Каталог: CG90649-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.