After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Яванский макак GNAO1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus GNAO1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_005591961.1
Размер кДНК:1065bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O.
Синоним гена:GNAO1
Виды:Cynomolgus
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Яванский макак GNAO1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Яванский макак GNAO1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90745-ACGRBS15400
Яванский макак GNAO1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90745-ACRRBS15396
Яванский макак GNAO1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90745-CFRBS13340
Яванский макак GNAO1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90745-CHRBS13343
Яванский макак GNAO1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90745-CMRBS13343
Яванский макак GNAO1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90745-CYRBS13343
Яванский макак GNAO1 Джин клон кДНК в вектор клонированияCG90745-GRBS5132
Яванский макак GNAO1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90745-NFRBS13343
Яванский макак GNAO1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90745-NHRBS13340
Яванский макак GNAO1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90745-NMRBS13340
Яванский макак GNAO1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90745-NYRBS13343
Яванский макак GNAO1 Джин ORF экспрессии кДНК клона плазмидыCG90745-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90745-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».