Быстрый заказ

Резус-фактор GGCT Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Яванский макак GGCT Информация о продукте «Клон cDNA»
    Размер кДНК:567bp
    Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) gamma-glutamylcyclotransferase with N terminal His tag.
    Синоним гена:GGCT
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Резус-фактор GGCT Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Резус-фактор GGCT Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90618-ACGRBS15400
    Резус-фактор GGCT Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90618-ACRRBS15400
    Резус-фактор GGCT Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90618-ANGRBS15400
    Резус-фактор GGCT Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90618-ANRRBS15400
    Резус-фактор GGCT Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90618-CFRBS13340
    Резус-фактор GGCT Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90618-CHRBS13340
    Резус-фактор GGCT Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90618-CMRBS13340
    Резус-фактор GGCT Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90618-CYRBS13340
    Резус-фактор GGCT Джин клон кДНК в вектор клонированияCG90618-GRBS5130
    Резус-фактор GGCT Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90618-NFRBS13340
    Резус-фактор GGCT Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90618-NHRBS13340
    Резус-фактор GGCT Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90618-NMRBS13340
    Резус-фактор GGCT Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90618-NYRBS13340
    Резус-фактор GGCT Джин ORF экспрессии кДНК клона плазмидыCG90618-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name

    GGCT belongs to the gamma-glutamylcyclotransferase family. It catalyzes the formation of 5-oxoproline from gamma-glutamyl dipeptides, the penultimate step in glutathione catabolism. GGCT may play a significant role in glutathione homeostasis. GGCT also induces release of cytochrome c from mitochondria with resultant induction of apoptosis. Pseudogenes of GGCT gene are located on the long arm of chromosome 5 and the short arm of chromosomes 2 and 20. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

  • Wagner SA. et al., 2011, Mol Cell Proteomics. 10 (10): M111.013284.
  • Kim W. et al., 2011, Mol Cell. 44 (2): 325-40.
  • Amano T. et al., 2012, J Histochem Cytochem. 60 (1): 76-86.
  • Size / Price
    Каталог: CG90618-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.