After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Резус-фактор GGCT Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus GGCT Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001266969.1
Размер кДНК:567bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) gamma-glutamylcyclotransferase with N terminal His tag.
Синоним гена:GGCT
Виды:Rhesus
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Резус-фактор GGCT Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Резус-фактор GGCT Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90618-ACGRBS15400
Резус-фактор GGCT Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90618-ACRRBS15400
Резус-фактор GGCT Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90618-ANGRBS15400
Резус-фактор GGCT Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90618-ANRRBS15400
Резус-фактор GGCT Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90618-CFRBS13340
Резус-фактор GGCT Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90618-CHRBS13340
Резус-фактор GGCT Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90618-CMRBS13340
Резус-фактор GGCT Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90618-CYRBS13340
Резус-фактор GGCT Джин клон кДНК в вектор клонированияCG90618-GRBS5130
Резус-фактор GGCT Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90618-NFRBS13340
Резус-фактор GGCT Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90618-NHRBS13340
Резус-фактор GGCT Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90618-NMRBS13340
Резус-фактор GGCT Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90618-NYRBS13340
Резус-фактор GGCT Джин ORF экспрессии кДНК клона плазмидыCG90618-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

GGCT belongs to the gamma-glutamylcyclotransferase family. It catalyzes the formation of 5-oxoproline from gamma-glutamyl dipeptides, the penultimate step in glutathione catabolism. GGCT may play a significant role in glutathione homeostasis. GGCT also induces release of cytochrome c from mitochondria with resultant induction of apoptosis. Pseudogenes of GGCT gene are located on the long arm of chromosome 5 and the short arm of chromosomes 2 and 20. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

Ссылки
  • Wagner SA. et al., 2011, Mol Cell Proteomics. 10 (10): M111.013284.
  • Kim W. et al., 2011, Mol Cell. 44 (2): 325-40.
  • Amano T. et al., 2012, J Histochem Cytochem. 60 (1): 76-86.
  • Size / Price
    Каталог: CG90618-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».