GDI1 cDNA ORF Clone, Cynomolgus, N-Myc tag

Price:
Size:
Number:

GDI1 cDNA ORF Clone, Cynomolgus, N-Myc tag: General Information

Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
1344 bp
Description
Full length Clone DNA of Cynomolgus GDP dissociation inhibitor 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

GDI1 Background Information

Rab GDP-dissociation inhibitors (GDI) are evolutionarily conserved proteins that play an essential role in the recycling of Rab GTPases required for vesicular transport through the secretory pathway. Both functional and developmental alterations in the neuron may account for the severe impairment of learning abilities as a consequence of mutations in GDI1.
Full Name
GDP dissociation inhibitor 1
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait