Быстрый заказ

Text Size:AAA

Резус-фактор GDF15/MIC-1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus GDF15 Информация о продукте «Клон cDNA»
Размер кДНК:927bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) growth differentiation factor 15 with C terminal Myc tag.
Синоним гена:GDF15
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Резус-фактор GDF15/MIC-1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Резус-фактор GDF15/MIC-1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90069-ACGRBS15400
Резус-фактор GDF15/MIC-1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90069-ACRRBS15400
Резус-фактор GDF15/MIC-1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90069-CFRBS13340
Резус-фактор GDF15/MIC-1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90069-CHRBS13340
Резус-фактор GDF15/MIC-1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90069-CMRBS13340
Резус-фактор GDF15/MIC-1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90069-CYRBS13340
Резус-фактор GDF15/MIC-1 Джин клон кДНК в вектор клонированияCG90069-GRBS5130
Резус-фактор GDF15/MIC-1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90069-NFRBS13340
Резус-фактор GDF15/MIC-1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90069-NHRBS13340
Резус-фактор GDF15/MIC-1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90069-NMRBS13340
Резус-фактор GDF15/MIC-1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90069-NYRBS13340
Резус-фактор GDF15/MIC-1 Джин ORF экспрессии кДНК клона плазмидыCG90069-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Growth-differentiation factor 15 (GDF15), also known as MIC-1, is a secreted member of the transforming growth factor (TGF)-β superfamily, as a novel antihypertrophic regulatory factor in the heart. GDF-15 / GDF15 is not expressed in the normal adult heart but is induced in response to conditions that promote hypertrophy and dilated cardiomyopathy and it is expressed highly in liver. GDF-15 / GDF15 has a role in regulating inflammatory and apoptotic pathways in injured tissues and during disease processes. GDF-15 / GDF15 is synthesized as precursor molecules that are processed at a dibasic cleavage site to release C-terminal domains containing a characteristic motif of 7 conserved cysteines in the mature protein. GDF-15 / GDF15 overexpression arising from an expanded erythroid compartment contributes to iron overload in thalassemia syndromes by inhibiting hepcidin expression.

  • Ago T, et al. (2006) GDF15, a cardioprotective TGF-beta superfamily protein. Circ Res. 98 (3): 294-297.
  • Hsiao E, et al. (2000) Characterization of growth-differentiation factor 15, a transforming growth factor beta superfamily member induced following liver injury. Mol Cell Biol. 20 (10): 3742-51.
  • Zimmers T, et al. (2005) Growth differentiation factor-15/macrophage inhibitory cytokine-1 induction after kidney and lung injury. Shock. 23 (6): 543-8.
  • Size / Price
    Каталог: CG90069-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.