After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Яванский макак GAPDH Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus GAPDH Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_005569912.1
Размер кДНК:1008bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) glyceraldehyde-3-phosphate dehydrogenase with C terminal Myc tag.
Синоним гена:GAPDH
Виды:Cynomolgus
переносчик:pCMV3-C-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Яванский макак GAPDH Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Яванский макак GAPDH Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90448-ACGRBS15400
Яванский макак GAPDH Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90448-ACRRBS15400
Яванский макак GAPDH Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90448-ANGRBS15400
Яванский макак GAPDH Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90448-ANRRBS15400
Яванский макак GAPDH Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90448-CFRBS13340
Яванский макак GAPDH Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90448-CHRBS13340
Яванский макак GAPDH Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90448-CMRBS13340
Яванский макак GAPDH Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90448-CYRBS13340
Яванский макак GAPDH Джин клон кДНК в вектор клонированияCG90448-GRBS5130
Яванский макак GAPDH Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90448-NFRBS13340
Яванский макак GAPDH Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90448-NHRBS13340
Яванский макак GAPDH Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90448-NMRBS13340
Яванский макак GAPDH Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90448-NYRBS13340
Яванский макак GAPDH Джин ORF экспрессии кДНК клона плазмидыCG90448-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Glyceraldehyde 3-phosphate dehydrogenase (GAPDH or G3PDH) is an enzyme of about 37kDa that is consisdered as a cellular enzyme involved in glycolysis. It catelyzes the sixth step of glycolysis. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a pleiotropic enzyme that is overexpressed in apoptosis and in several human chronic pathologies. Its role as a mediator for cell death has also been highlighted. A recent report suggests that GAPDH may be genetically associated with late-onset of Alzheimer's disease. Besides, deprenyl, which has originally been used as a monoamine oxidase inhibitor for Parkinson's disease, binds to GAPDH and displays neuroprotective actions.

Ссылки
  • Hara MR, et al. (2006) Neuroprotection by pharmacologic blockade of the GAPDH death cascade. PNA. 103 (10): 3887-9.
  • Hara MR, et al. (2006) GAPDH as a sensor of NO stress.Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease. 1762 (5): 502-9.
  • Tarze A, et al. (2007) GAPDH, a novel regulator of the pro-apoptotic mitochondrial membrane permeabilizationGAPDH and apoptosis. Oncogene. 26: 2606-20.
  • Yi MK, et al. (2000) Functional Significance of the Interaction of Hepatitis A Virus RNA with Glyceraldehyde 3-Phosphate Dehydrogenase (GAPDH): Opposing Effects of GAPDH and Polypyrimidine Tract Binding Protein on Internal Ribosome Entry Site Function. Journal of Virology. 74 (14) : 6459-68.
  • Size / Price
    Каталог: CG90448-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».