FRZB cDNA ORF Clone, Rhesus, N-HA tag

Price:
Size:
Number:

FRZB cDNA ORF Clone, Rhesus, N-HA tag: General Information

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
978 bp
Description
Full length Clone DNA of Rhesus frizzled-related protein with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

FRZB Background Information

FRZB also known as sFRP-3, is a secreted protein containing a domain similar to the putative Wnt-binding region of the frizzled family of transmembrane receptors. FRZB is widely expressed in adult mammalian tissues. In the Xenopus gastrula, FRZB is regulated as a typical Spemann organizer component. FRZB also functions as a competitor for the cell-surface G-protein receptor Frizzled. It is espically important in embryonic development. Defects in FRZB gene can cause female-specific osteoarthritis (OA) susceptibility. FRZB may serve an important role in determining hip shape and may modify the relationship between hip shape and OA.
Full Name
frizzled-related protein
References
  • Hoang B., et al.,(1996), Primary structure and tissue distribution of FRZB, a novel protein related to Drosophila frizzled, suggest a role in skeletal morphogenesis. J. Biol. Chem. 271:26131-26137.
  • Mayr T., et al., (1997), Fritz: a secreted frizzled-related protein that inhibits Wnt activity.Mech. Dev. 63:109-125.
  • Leyns L., et al.,(1997), Frzb-1 is a secreted antagonist of Wnt signaling expressed in the Spemann organizer.Cell 88:747-756.

FRZB cDNA ORF Clone, Human, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait