Быстрый заказ

Резус-фактор FRZB / sFRP-3 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus FRZB Информация о продукте «Клон cDNA»
Размер кДНК:978bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) frizzled-related protein with N terminal HA tag.
Синоним гена:FRZB
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Резус-фактор FRZB / sFRP-3 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Резус-фактор FRZB / sFRP-3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90406-ACGRBS15400
Резус-фактор FRZB / sFRP-3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90406-ACRRBS15400
Резус-фактор FRZB / sFRP-3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90406-CFRBS13340
Резус-фактор FRZB / sFRP-3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90406-CHRBS13340
Резус-фактор FRZB / sFRP-3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90406-CMRBS13340
Резус-фактор FRZB / sFRP-3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90406-CYRBS13340
Резус-фактор FRZB / sFRP-3 Джин клон кДНК в вектор клонированияCG90406-GRBS5130
Резус-фактор FRZB / sFRP-3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90406-NFRBS13340
Резус-фактор FRZB / sFRP-3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90406-NHRBS13340
Резус-фактор FRZB / sFRP-3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90406-NMRBS13340
Резус-фактор FRZB / sFRP-3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90406-NYRBS13340
Резус-фактор FRZB / sFRP-3 Джин ORF экспрессии кДНК клона плазмидыCG90406-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

FRZB also known as sFRP-3, is a secreted protein containing a domain similar to the putative Wnt-binding region of the frizzled family of transmembrane receptors. FRZB is widely expressed in adult mammalian tissues. In the Xenopus gastrula, FRZB is regulated as a typical Spemann organizer component. FRZB also functions as a competitor for the cell-surface G-protein receptor Frizzled. It is espically important in embryonic development. Defects in FRZB gene can cause female-specific osteoarthritis (OA) susceptibility. FRZB may serve an important role in determining hip shape and may modify the relationship between hip shape and OA.

Size / Price
Каталог: CG90406-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.