Быстрый заказ

Резус-фактор FGF12 / FGF-12 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus FGF12 Информация о продукте «Клон cDNA»
Размер кДНК:732bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) fibroblast growth factor 12 with C terminal Myc tag.
Синоним гена:FGF12
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Резус-фактор FGF12 / FGF-12 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Резус-фактор FGF12 / FGF-12 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90074-ACGRBS15400
Резус-фактор FGF12 / FGF-12 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90074-ACRRBS15400
Резус-фактор FGF12 / FGF-12 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90074-ANGRBS15400
Резус-фактор FGF12 / FGF-12 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90074-ANRRBS15400
Резус-фактор FGF12 / FGF-12 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90074-CFRBS13340
Резус-фактор FGF12 / FGF-12 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90074-CHRBS13340
Резус-фактор FGF12 / FGF-12 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90074-CMRBS13340
Резус-фактор FGF12 / FGF-12 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90074-CYRBS13340
Резус-фактор FGF12 / FGF-12 Джин клон кДНК в вектор клонированияCG90074-GRBS5130
Резус-фактор FGF12 / FGF-12 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90074-NFRBS13340
Резус-фактор FGF12 / FGF-12 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90074-NHRBS13340
Резус-фактор FGF12 / FGF-12 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90074-NMRBS13340
Резус-фактор FGF12 / FGF-12 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90074-NYRBS13340
Резус-фактор FGF12 / FGF-12 Джин ORF экспрессии кДНК клона плазмидыCG90074-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

FGF12 is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth, and invasion. FGF12 lacks the N-terminal signal sequence present in most of the FGF family members, but it contains clusters of basic residues that have been demonstrated to act as a nuclear localization signal. When transfected into mammalian cells, FGF12 accumulated in the nucleus, but was not secreted. The specific function of FGF12 gene has not yet been determined. Two alternatively spliced transcript variants encoding distinct isoforms have been reported.

  • Liu Y. et al., 1997, Cytogenet Cell Genet. 78 (1): 48-9.
  • Robertson NG. et al., 1995, Genomics. 23 (1): 42-50.
  • Smallwood PM. et al., 1996, Proc Natl Acad Sci. 93 (18): 9850-7.
  • Size / Price
    Каталог: CG90074-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.