Быстрый заказ

Text Size:AAA

Резус-фактор aFGF/FGF1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus FGF1 Информация о продукте «Клон cDNA»
Размер кДНК:468bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) fibroblast growth factor 1 (acidic) with C terminal Myc tag.
Синоним гена:FGF1
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Резус-фактор aFGF/FGF1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Резус-фактор aFGF/FGF1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90062-ACGRBS15400
Резус-фактор aFGF/FGF1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90062-ACRRBS15400
Резус-фактор aFGF/FGF1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90062-ANGRBS15400
Резус-фактор aFGF/FGF1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90062-ANRRBS15400
Резус-фактор aFGF/FGF1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90062-CFRBS13340
Резус-фактор aFGF/FGF1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90062-CHRBS13340
Резус-фактор aFGF/FGF1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90062-CMRBS13340
Резус-фактор aFGF/FGF1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90062-CYRBS13340
Резус-фактор aFGF/FGF1 Джин клон кДНК в вектор клонированияCG90062-GRBS5130
Резус-фактор aFGF/FGF1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90062-NFRBS13340
Резус-фактор aFGF/FGF1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90062-NHRBS13340
Резус-фактор aFGF/FGF1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90062-NMRBS13340
Резус-фактор aFGF/FGF1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90062-NYRBS13340
Резус-фактор aFGF/FGF1 Джин ORF экспрессии кДНК клона плазмидыCG90062-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

aFGF, also known as FGF1 and HBGF-1, is a member of the fibroblast growth factor family. The biological activity of aFGF protein is exerted through binding to four high affinity cell surface receptors (FGFR1–4), which results in receptor dimerization and transphosphorylation in the tyrosine kinase domain. aFGF protein shows a wide range of endocrine-like activities. As a multiple function growth factor, this protein is involved in embryo development and tissue repair. Additionally, this protein is considered to function in several important physiological and pathological processes, such as embryonic development, morphogenesis, angiogenesis, wound healing and atheromatosis, carcinogenesis, development, and invasion of cancer.


Size / Price
Каталог: CG90062-CM
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.