After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Резус-фактор CD16/Fc gamma RIII Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus FCGR3 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:EF396938.1
Размер кДНК:765bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) Fc gamma RIIIa with N terminal Myc tag.
Синоним гена:FCGR3, FcRIII
Виды:Rhesus
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Резус-фактор CD16/Fc gamma RIII Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Резус-фактор CD16/Fc gamma RIII Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90013-ACGRBS15400
Резус-фактор CD16/Fc gamma RIII Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90013-ACRRBS15400
Резус-фактор CD16/Fc gamma RIII Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90013-CFRBS13340
Резус-фактор CD16/Fc gamma RIII Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90013-CHRBS13340
Резус-фактор CD16/Fc gamma RIII Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90013-CMRBS13340
Резус-фактор CD16/Fc gamma RIII Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90013-CYRBS13340
Резус-фактор CD16/Fc gamma RIII Джин клон кДНК в вектор клонированияCG90013-MRBS5130
Резус-фактор CD16/Fc gamma RIII Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90013-NFRBS13340
Резус-фактор CD16/Fc gamma RIII Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90013-NHRBS13340
Резус-фактор CD16/Fc gamma RIII Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90013-NMRBS13340
Резус-фактор CD16/Fc gamma RIII Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90013-NYRBS13340
Резус-фактор CD16/Fc gamma RIII Джин ORF экспрессии кДНК клона плазмидыCG90013-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Fc receptors bind the most common class of antibody, IgG, are called Fc gamma receptors (FcγR). FcγR is divided into three classes, Fc γ RI (CD64), Fc γ RII (CD32), and Fc γ RIII (CD16). CD16 protein is a multifunctional, low/intermediate affinity receptor, which belongs to the immunoglobulin superfamily. It is found on the surface of natural killer cells, neutrophil polymorphonuclear leukocytes, monocytes and macrophages. Mouse CD16 is encoded by a single gene, while, human CD16 is expressed as two distinct forms (CD16a/FcγRIIIa and CD16b/FcγRIIIb) encoded by two different highly homologous genes in a cell type-specific manner. CD16 is involved in phagocytosis, secretion of enzymes, inflammatory mediators, antibody-dependent cellular cytotoxicity (ADCC), and clearance of immune complexes.

Ссылки
  • Edberg JC, et al. (2002) Genetic linkage and association of Fcgamma receptor IIIA (CD16A) on chromosome 1q23 with human systemic lupus erythematosus. Arthritis Rheum. 46(8): 2132-40.
  • Li P, et al. (2002) Recombinant CD16A-Ig forms a homodimer and cross-blocks the ligand binding functions of neutrophil and monocyte Fcgamma receptors. Mol Immunol. 38(7): 527-38.
  • Li P, et al. (2007) Affinity and kinetic analysis of Fcgamma receptor IIIa (CD16a) binding to IgG ligands. J Biol Chem. 282(9): 6210-21.
  • Size / Price
    Каталог: CG90013-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».