After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Резус-фактор CD32a/FCGR2A/Fc gamma RIIA Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus FCGR2A Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_001118066.2
Размер кДНК:948bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) Fc fragment of IgG, low affinity IIa, receptor with N terminal Myc tag.
Синоним гена:FCGR2A, CD32a
Виды:Rhesus
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Резус-фактор CD32a/FCGR2A/Fc gamma RIIA Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Резус-фактор CD32a/FCGR2A/Fc gamma RIIA Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90016-ACGRBS15400
Резус-фактор CD32a/FCGR2A/Fc gamma RIIA Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90016-ACRRBS15400
Резус-фактор CD32a/FCGR2A/Fc gamma RIIA Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90016-CFRBS13340
Резус-фактор CD32a/FCGR2A/Fc gamma RIIA Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90016-CHRBS13340
Резус-фактор CD32a/FCGR2A/Fc gamma RIIA Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90016-CMRBS13340
Резус-фактор CD32a/FCGR2A/Fc gamma RIIA Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90016-CYRBS13340
Резус-фактор CD32a/FCGR2A/Fc gamma RIIA Джин клон кДНК в вектор клонированияCG90016-MRBS5130
Резус-фактор CD32a/FCGR2A/Fc gamma RIIA Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90016-NFRBS13340
Резус-фактор CD32a/FCGR2A/Fc gamma RIIA Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90016-NHRBS13340
Резус-фактор CD32a/FCGR2A/Fc gamma RIIA Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90016-NMRBS13340
Резус-фактор CD32a/FCGR2A/Fc gamma RIIA Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90016-NYRBS13340
Резус-фактор CD32a/FCGR2A/Fc gamma RIIA Джин ORF экспрессии кДНК клона плазмидыCG90016-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90016-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».