Быстрый заказ

Яванский макак FABP3/H-FABP Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus FABP3 Информация о продукте «Клон cDNA»
Размер кДНК:402bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) fatty acid binding protein 3, muscle and heart (mammary-derived growth inhibitor) with C terminal HA tag.
Синоним гена:FABP3
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Яванский макак FABP3/H-FABP Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Яванский макак FABP3/H-FABP Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90397-ACGRBS15400
Яванский макак FABP3/H-FABP Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90397-ACRRBS15400
Яванский макак FABP3/H-FABP Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90397-ANGRBS15400
Яванский макак FABP3/H-FABP Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90397-ANRRBS15400
Яванский макак FABP3/H-FABP Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90397-CFRBS13340
Яванский макак FABP3/H-FABP Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90397-CHRBS13340
Яванский макак FABP3/H-FABP Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90397-CMRBS13340
Яванский макак FABP3/H-FABP Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90397-CYRBS13340
Яванский макак FABP3/H-FABP Джин клон кДНК в вектор клонированияCG90397-GRBS5130
Яванский макак FABP3/H-FABP Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90397-NFRBS13340
Яванский макак FABP3/H-FABP Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90397-NHRBS13340
Яванский макак FABP3/H-FABP Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90397-NMRBS13340
Яванский макак FABP3/H-FABP Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90397-NYRBS13340
Яванский макак FABP3/H-FABP Джин ORF экспрессии кДНК клона плазмидыCG90397-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90397-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.