After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Яванский макак ENTPD6 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus ENTPD6 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_005568142.1
Размер кДНК:801bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) ectonucleoside triphosphate diphosphohydrolase 6 (putative) with N terminal Myc tag.
Синоним гена:ENTPD6
Виды:Cynomolgus
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Яванский макак ENTPD6 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Яванский макак ENTPD6 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90664-ACGRBS15400
Яванский макак ENTPD6 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90664-ACRRBS15400
Яванский макак ENTPD6 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90664-CFRBS13340
Яванский макак ENTPD6 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90664-CHRBS13340
Яванский макак ENTPD6 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90664-CMRBS13340
Яванский макак ENTPD6 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90664-CYRBS13340
Яванский макак ENTPD6 Джин клон кДНК в вектор клонированияCG90664-GRBS5130
Яванский макак ENTPD6 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90664-NFRBS13340
Яванский макак ENTPD6 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90664-NHRBS13340
Яванский макак ENTPD6 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90664-NMRBS13340
Яванский макак ENTPD6 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90664-NYRBS13340
Яванский макак ENTPD6 Джин ORF экспрессии кДНК клона плазмидыCG90664-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90664-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».