Быстрый заказ

Резус-фактор ENO1 / Enolase 1 / alpha-enolase Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Яванский макак ENO1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_001195611.1
    Размер кДНК:1305bp
    Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) enolase 1, (alpha) with C terminal His tag.
    Синоним гена:ENO1
    Виды:Rhesus
    переносчик:pCMV3-C-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Резус-фактор ENO1 / Enolase 1 / alpha-enolase Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Резус-фактор ENO1 / Enolase 1 / alpha-enolase Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90355-ACGRBS15400
    Резус-фактор ENO1 / Enolase 1 / alpha-enolase Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90355-ACRRBS15400
    Резус-фактор ENO1 / Enolase 1 / alpha-enolase Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90355-ANGRBS15400
    Резус-фактор ENO1 / Enolase 1 / alpha-enolase Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90355-ANRRBS15400
    Резус-фактор ENO1 / Enolase 1 / alpha-enolase Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90355-CFRBS13340
    Резус-фактор ENO1 / Enolase 1 / alpha-enolase Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90355-CHRBS13340
    Резус-фактор ENO1 / Enolase 1 / alpha-enolase Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90355-CMRBS13340
    Резус-фактор ENO1 / Enolase 1 / alpha-enolase Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90355-CYRBS13340
    Резус-фактор ENO1 / Enolase 1 / alpha-enolase Джин клон кДНК в вектор клонированияCG90355-GRBS5130
    Резус-фактор ENO1 / Enolase 1 / alpha-enolase Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90355-NFRBS13340
    Резус-фактор ENO1 / Enolase 1 / alpha-enolase Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90355-NHRBS13340
    Резус-фактор ENO1 / Enolase 1 / alpha-enolase Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90355-NMRBS13340
    Резус-фактор ENO1 / Enolase 1 / alpha-enolase Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90355-NYRBS13340
    Резус-фактор ENO1 / Enolase 1 / alpha-enolase Джин ORF экспрессии кДНК клона плазмидыCG90355-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Ссылки
  • Capello M, et al. (2011) a-Enolase: a promising therapeutic and diagnostic tumor target. FEBS J. 278(7): 1064-74.
  • Kang HJ, et al. (2008) Structure of human alpha-enolase (hENO1), a multifunctional glycolytic enzyme. Acta Crystallogr D Biol Crystallogr. 64(Pt 6): 651-7.
  • Lopez-Alemany R, et al. (2005) Alpha-enolase plasminogen receptor in myogenesis. Front Biosci. 10: 30-6.
  • Ejeskdr K, et al. (2005) Introduction of in vitro transcribed ENO1 mRNA into neuroblastoma cells induces cell death. BMC Cancer. 5: 161.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».