After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Резус-фактор ENO1 / Enolase 1 / alpha-enolase Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus ENO1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001195611.1
Размер кДНК:1305bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) enolase 1, (alpha) with C terminal His tag.
Синоним гена:ENO1
Виды:Rhesus
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Резус-фактор ENO1 / Enolase 1 / alpha-enolase Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Резус-фактор ENO1 / Enolase 1 / alpha-enolase Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90355-ACGRBS15400
Резус-фактор ENO1 / Enolase 1 / alpha-enolase Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90355-ACRRBS15400
Резус-фактор ENO1 / Enolase 1 / alpha-enolase Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90355-ANGRBS15400
Резус-фактор ENO1 / Enolase 1 / alpha-enolase Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90355-ANRRBS15400
Резус-фактор ENO1 / Enolase 1 / alpha-enolase Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90355-CFRBS13340
Резус-фактор ENO1 / Enolase 1 / alpha-enolase Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90355-CHRBS13340
Резус-фактор ENO1 / Enolase 1 / alpha-enolase Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90355-CMRBS13340
Резус-фактор ENO1 / Enolase 1 / alpha-enolase Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90355-CYRBS13340
Резус-фактор ENO1 / Enolase 1 / alpha-enolase Джин клон кДНК в вектор клонированияCG90355-GRBS5130
Резус-фактор ENO1 / Enolase 1 / alpha-enolase Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90355-NFRBS13340
Резус-фактор ENO1 / Enolase 1 / alpha-enolase Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90355-NHRBS13340
Резус-фактор ENO1 / Enolase 1 / alpha-enolase Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90355-NMRBS13340
Резус-фактор ENO1 / Enolase 1 / alpha-enolase Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90355-NYRBS13340
Резус-фактор ENO1 / Enolase 1 / alpha-enolase Джин ORF экспрессии кДНК клона плазмидыCG90355-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Ссылки
  • Capello M, et al. (2011) a-Enolase: a promising therapeutic and diagnostic tumor target. FEBS J. 278(7): 1064-74.
  • Kang HJ, et al. (2008) Structure of human alpha-enolase (hENO1), a multifunctional glycolytic enzyme. Acta Crystallogr D Biol Crystallogr. 64(Pt 6): 651-7.
  • Lopez-Alemany R, et al. (2005) Alpha-enolase plasminogen receptor in myogenesis. Front Biosci. 10: 30-6.
  • Ejeskdr K, et al. (2005) Introduction of in vitro transcribed ENO1 mRNA into neuroblastoma cells induces cell death. BMC Cancer. 5: 161.
  • Size / Price
    Каталог: CG90355-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».