Быстрый заказ

Яванский макак Integrin beta 4 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus EIF6 Информация о продукте «Клон cDNA»
Размер кДНК:738bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) eukaryotic translation initiation factor 6 with C terminal HA tag.
Синоним гена:EIF6
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Яванский макак Integrin beta 4 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Яванский макак Integrin beta 4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90408-ACGRBS15400
Яванский макак Integrin beta 4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90408-ACRRBS15400
Яванский макак Integrin beta 4 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90408-ANGRBS15400
Яванский макак Integrin beta 4 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90408-ANRRBS15400
Яванский макак Integrin beta 4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90408-CFRBS13340
Яванский макак Integrin beta 4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90408-CHRBS13340
Яванский макак Integrin beta 4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90408-CMRBS13340
Яванский макак Integrin beta 4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90408-CYRBS13340
Яванский макак Integrin beta 4 Джин клон кДНК в вектор клонированияCG90408-GRBS5130
Яванский макак Integrin beta 4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90408-NFRBS13340
Яванский макак Integrin beta 4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90408-NHRBS13340
Яванский макак Integrin beta 4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90408-NMRBS13340
Яванский макак Integrin beta 4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90408-NYRBS13340
Яванский макак Integrin beta 4 Джин ORF экспрессии кДНК клона плазмидыCG90408-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90408-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.