After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Резус-фактор EIF1AX Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus EIF1AX Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001261777.1
Размер кДНК:435bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) eukaryotic translation initiation factor 1A, X-linked with N terminal Myc tag.
Синоним гена:EIF1AY
Виды:Rhesus
переносчик:pCMV3-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Резус-фактор EIF1AX Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Резус-фактор EIF1AX Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90658-ACGRBS15400
Резус-фактор EIF1AX Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90658-ACRRBS15400
Резус-фактор EIF1AX Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90658-ANGRBS15400
Резус-фактор EIF1AX Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90658-ANRRBS15400
Резус-фактор EIF1AX Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90658-CFRBS13340
Резус-фактор EIF1AX Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90658-CHRBS13340
Резус-фактор EIF1AX Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90658-CMRBS13340
Резус-фактор EIF1AX Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90658-CYRBS13340
Резус-фактор EIF1AX Джин клон кДНК в вектор клонированияCG90658-GRBS5130
Резус-фактор EIF1AX Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90658-NFRBS13340
Резус-фактор EIF1AX Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90658-NHRBS13340
Резус-фактор EIF1AX Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90658-NMRBS13340
Резус-фактор EIF1AX Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90658-NYRBS13340
Резус-фактор EIF1AX Джин ORF экспрессии кДНК клона плазмидыCG90658-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90658-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».