Быстрый заказ

Text Size:AAA

Яванский макак EF1B / EEF1B2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus EEF1B2 Информация о продукте «Клон cDNA»
Размер кДНК:678bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) eukaryotic translation elongation factor 1 beta 2 with N terminal Flag tag.
Синоним гена:EEF1B2
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Яванский макак EF1B / EEF1B2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Яванский макак EF1B / EEF1B2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90457-ACGRBS15400
Яванский макак EF1B / EEF1B2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90457-ACRRBS15400
Яванский макак EF1B / EEF1B2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90457-ANGRBS15400
Яванский макак EF1B / EEF1B2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90457-ANRRBS15400
Яванский макак EF1B / EEF1B2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90457-CFRBS13340
Яванский макак EF1B / EEF1B2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90457-CHRBS13340
Яванский макак EF1B / EEF1B2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90457-CMRBS13340
Яванский макак EF1B / EEF1B2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90457-CYRBS13340
Яванский макак EF1B / EEF1B2 Джин клон кДНК в вектор клонированияCG90457-GRBS5130
Яванский макак EF1B / EEF1B2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90457-NFRBS13340
Яванский макак EF1B / EEF1B2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90457-NHRBS13340
Яванский макак EF1B / EEF1B2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90457-NMRBS13340
Яванский макак EF1B / EEF1B2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90457-NYRBS13340
Яванский макак EF1B / EEF1B2 Джин ORF экспрессии кДНК клона плазмидыCG90457-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

EF1B, also known as EEF1B2, is a translation elongation factor. It belongs to the EF-1-beta/EF-1-delta family. Elongation factors are a set of proteins that are used in protein synthesis in the cell. In the ribosome, they facilitate translational elongation, from the formation of the first peptide bond to the formation of the last one. EF1B is more complex in eukaryotes than in bacteria, and consists of three subunits: EF1B-alpha, EF1B-gamma and EF1B-beta. EF1B contains 1 GST C-terminal domain. It is involved in the transfer of aminoacylated tRNAs to the ribosome. EF1B is required to regenerate EF1A from its inactive form (EF1A-GDP) to its active form (EF1A-GTP). EF1A is then ready to interact with a new aminoacyl-tRNA to begin the cycle again.

  • Pizzuti A. et al., 1994, Biochem Biophys Res Commun. 197 (1): 154-62.
  • Rual. et al., 2005, Nature. 437 (7062): 1173-8.
  • Stelzl. et al., 2005, Cell. 122 (6): 957-68.
  • Sang Lee. et al., 2002, Biochem Biophys Res Commun. 291 (1): 158-64.
  • Size / Price
    Каталог: CG90457-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.