Быстрый заказ

Резус-фактор DPP4 / CD26 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus DPP4 Информация о продукте «Клон cDNA»
Размер кДНК:2301bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) dipeptidyl-peptidase 4 with C terminal Flag tag.
Синоним гена:DPP4
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Резус-фактор DPP4 / CD26 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Резус-фактор DPP4 / CD26 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90180-ACGRBS16760
Резус-фактор DPP4 / CD26 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90180-ACRRBS16760
Резус-фактор DPP4 / CD26 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90180-CFRBS14710
Резус-фактор DPP4 / CD26 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90180-CHRBS14710
Резус-фактор DPP4 / CD26 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90180-CMRBS14710
Резус-фактор DPP4 / CD26 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90180-CYRBS14710
Резус-фактор DPP4 / CD26 Джин клон кДНК в вектор клонированияCG90180-GRBS5130
Резус-фактор DPP4 / CD26 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90180-NFRBS14710
Резус-фактор DPP4 / CD26 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90180-NHRBS14710
Резус-фактор DPP4 / CD26 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90180-NMRBS14710
Резус-фактор DPP4 / CD26 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90180-NYRBS14710
Резус-фактор DPP4 / CD26 Джин ORF экспрессии кДНК клона плазмидыCG90180-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Dipeptidyl peptidase-4 (DPP4) or adenosine deaminase complexing protein 2 (ADCP 2) or T-cell activation antigen CD26 is a serine exopeptidase belonging to the S9B protein family that cleaves X-proline dipeptides from the N-terminus of polypeptides, such as chemokines, neuropeptides, and peptide hormones. The enzyme is a type II transmembrane glycoprotein, expressed on the surface of many cell types. It is also present in serum and other body fluids in a truncated form (sCD26/DPPIV). The soluble CD26 (sCD26) as a tumour marker for the detection of colorectal cancer (CRC) and advanced adenomas. As both a regulatory enzyme and a signalling factor, DPP4 has been evaluated and described in many studies. DPP4 inhibition results in increased blood concentration of the incretin hormones glucagon-like peptide-1 (GLP-1) and gastric inhibitory polypeptide (GIP). This causes an increase in glucose-dependent stimulation, resulting in a lowering of blood glucose levels. Recent studies have shown that DPP4 inhibitors can induce a significant reduction in glycosylated haemoglobin (HbA(1c)) levels, either as monotherapy or as a combination with other antidiabetic agents. Research has also demonstrated that DPP4 inhibitors portray a very low risk of hypoglycaemia development, and are a new pharmacological class of drugs for treating Type 2 diabetes.

  • Doupis J, et al. (2008) DPP4 inhibitors: a new approach in diabetes treatment. Adv Ther. 25(7): 627-43.
  • Havre PA, et al. (2008) The role of CD26/dipeptidyl peptidase IV in cancer. Front Biosci. 13: 1634-45.
  • De Chiara L, et al. (2009) Soluble CD26 levels and its association to epidemiologic parameters in a sample population. Dis Markers. 7(6): 311-6.
  • Matteucci E, et al. (2009) Dipeptidyl peptidase-4 (CD26): knowing the function before inhibiting the enzyme. Curr Med Chem. 16(23): 2943-51.
  • Size / Price
    Каталог: CG90180-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.