DOCK10 cDNA ORF Clone, Cynomolgus, C-His tag

Price:
Size:
Number:

DOCK10 cDNA ORF Clone, Cynomolgus, C-His tag: General Information

Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
1335 bp
Description
Full length Clone DNA of Cynomolgus dedicator of cytokinesis 10 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

DOCK10 Background Information

Full Name
dedicator of cytokinesis 10
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait