Быстрый заказ

Text Size:AAA

Яванский макак DHX16 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus DHX16 Информация о продукте «Клон cDNA»
Размер кДНК:3135bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) DEAH (Asp-Glu-Ala-His) box polypeptide 16 with C terminal His tag.
Синоним гена:DHX16
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Яванский макак DHX16 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Яванский макак DHX16 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90348-ACGRBS22240
Яванский макак DHX16 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90348-ACRRBS22240
Яванский макак DHX16 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90348-ANGRBS22240
Яванский макак DHX16 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90348-ANRRBS22240
Яванский макак DHX16 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90348-CFRBS20190
Яванский макак DHX16 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90348-CHRBS20190
Яванский макак DHX16 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90348-CMRBS20190
Яванский макак DHX16 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90348-CYRBS20190
Яванский макак DHX16 Джин клон кДНК в вектор клонированияCG90348-GRBS5130
Яванский макак DHX16 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90348-NFRBS20190
Яванский макак DHX16 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90348-NHRBS20190
Яванский макак DHX16 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90348-NMRBS20190
Яванский макак DHX16 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90348-NYRBS20190
Яванский макак DHX16 Джин ORF экспрессии кДНК клона плазмидыCG90348-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90348-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.