Быстрый заказ

Резус-фактор BCA-1 / CXCL13 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Яванский макак CXCL13 Информация о продукте «Клон cDNA»
Размер кДНК:330bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) chemokine (C-X-C motif) ligand 13 with N terminal Myc tag.
Синоним гена:CXCL13, BLC
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Резус-фактор BCA-1 / CXCL13 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Резус-фактор BCA-1 / CXCL13 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90021-ACGRBS15400
Резус-фактор BCA-1 / CXCL13 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90021-ACRRBS15400
Резус-фактор BCA-1 / CXCL13 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90021-CFRBS13340
Резус-фактор BCA-1 / CXCL13 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90021-CHRBS13340
Резус-фактор BCA-1 / CXCL13 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90021-CMRBS13340
Резус-фактор BCA-1 / CXCL13 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90021-CYRBS13340
Резус-фактор BCA-1 / CXCL13 Джин клон кДНК в вектор клонированияCG90021-GRBS5130
Резус-фактор BCA-1 / CXCL13 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90021-NFRBS13340
Резус-фактор BCA-1 / CXCL13 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90021-NHRBS13340
Резус-фактор BCA-1 / CXCL13 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90021-NMRBS13340
Резус-фактор BCA-1 / CXCL13 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90021-NYRBS13340
Резус-фактор BCA-1 / CXCL13 Джин ORF экспрессии кДНК клона плазмидыCG90021-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

The chemokine CXCL13, also known as BCA-1 (B-cell-attracting chemokine-1) or BLC (B-lymphocyte chemoattractant), which belongs to the CXC chemokine family. CXCL13 and its receptor CXCR5 control the organization of B cells within follicles of lymphoid tissues. CXCL13 is known to dictate homing and motility of B cells in lymphoid tissue and has been implicated in the formation of ectopic lymphoid tissue in chronic inflammation. It involves in B-cell compartmental homing within secondary lymphoid organs and recently implicated in the pathogenesis of inflammatory and malignant lymphocyte-mediated diseases. In Primary central nervous system lymphoma (PCNSL), expression of BCA-1 by malignant lymphocytes and vascular endothelium may influence tumor development and localization to central nervous system (CNS). In T-lymphocytes, CXCL13 expression is thought to reflect a germinal center origin of the T-cell. CXCL13 expression may also provide an additional useful tool for the diagnosis of Angioimmunoblastic T-cell lymphoma (AITL).

  • Ansel KM, et al. (2000) A chemokine-driven positive feedback loop organizes lymphoid follicles. Nature. 406 (6793): 309-14.
  • Smith JR, et al. (2003) Expression of B-cell-attracting chemokine 1 (CXCL13) by malignant lymphocytes and vascular endothelium in primary central nervous system lymphoma. Blood. 101(3): 815-21.
  • Dupuis J, et al. (2006) Expression of CXCL13 by neoplastic cells in angioimmunoblastic T-cell lymphoma (AITL): a new diagnostic marker providing evidence that AITL derives from follicular helper T cells. Am J Surg Pathol. 30(4): 490-4.
  • de Leval L, et al. (2007) The gene expression profile of nodal peripheral T-cell lymphoma demonstrates a molecular link between angioimmunoblastic T-cell lymphoma (AITL) and follicular helper T (TFH) cells. Blood. 109 (11): 4952-63.
  • Schiffer L, et al. (2009) B-cell-attracting chemokine CXCL13 as a marker of disease activity and renal involvement in systemic lupus erythematosus (SLE). Nephrol Dial Transplant. 24(12): 3708-12.
  • Rupprecht TA, et al. (2009) The chemokine CXCL13 is a key regulator of B cell recruitment to the cerebrospinal fluid in acute Lyme neuroborreliosis. J Neuroinflammation. 6: 42.
  • Size / Price
    Каталог: CG90021-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.