Быстрый заказ

Резус-фактор SDF-1/CXCL12 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus CXCL12 Информация о продукте «Клон cDNA»
Размер кДНК:270bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) chemokine (C-X-C motif) ligand 12 with N terminal Myc tag.
Синоним гена:Img, LIG-1, D6Bwg0781e, Lrig1
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Резус-фактор SDF-1/CXCL12 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Резус-фактор SDF-1/CXCL12 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90009-ACGRBS15400
Резус-фактор SDF-1/CXCL12 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90009-ACRRBS15400
Резус-фактор SDF-1/CXCL12 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90009-CFRBS13340
Резус-фактор SDF-1/CXCL12 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90009-CHRBS13340
Резус-фактор SDF-1/CXCL12 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90009-CMRBS13340
Резус-фактор SDF-1/CXCL12 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90009-CYRBS13340
Резус-фактор SDF-1/CXCL12 Джин клон кДНК в вектор клонированияCG90009-MRBS5130
Резус-фактор SDF-1/CXCL12 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90009-NFRBS13340
Резус-фактор SDF-1/CXCL12 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90009-NHRBS13340
Резус-фактор SDF-1/CXCL12 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90009-NMRBS13340
Резус-фактор SDF-1/CXCL12 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90009-NYRBS13340
Резус-фактор SDF-1/CXCL12 Джин ORF экспрессии кДНК клона плазмидыCG90009-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

The human stromal cell-derived factor-1 (SDF1), also known as CXCL12, is a small (8 kDa) cytokine highly conserved chemotactic cytokine belonging to the large family of CXC chemokines. SDF1 is expressed in two isoforms from a single gene that encodes two splice variants, SDF1α and SDF1β, which are identical except for the four residues present in the C-terminus of SDF1β but absent from SDF1α. The chemokine CXCL12 [stromal cell-derived factor-1 (SDF-1)] binds primarily to CXC receptor 4 (CXCR4; CD184). The binding of CXCL12 to CXCR4 induces intracellular signaling through several divergent pathways initiating signals related to chemotaxis, cell survival and/or proliferation, increase in intracellular calcium, and gene transcription. CXCL12 and CXCR4 that have been widely characterized in peripheral tissues and delineate their main functions in the CNS. Extensive evidence supports CXCL12 as a key regulator for early development of the CNS. In the mature CNS, CXCL12 modulates neurotransmission, neurotoxicity and neuroglial interactions. CXCL12 has crucial roles in the formation of multiple organ systems during embryogenesis and in the regulation of bone marrow haematopoiesis and immune function in the postnatal organism. Although considered an important factor in normal bone metabolism, recent studies implicate CXCL12 in the pathogenesis of several diseases involving the skeleton, including rheumatoid arthritis and cancers that metastasize to bone. The CXCL12/CXCR4 axis is involved in tumor progression, angiogenesis, metastasis, and survival. Pathologically enhanced CXCL12 signaling may promote the formation of new vessels through recruiting circulating endothelial progenitor cells or directly enhancing the migration/growth of endothelial cells. Therefore, CXCL12 signaling represents an important mechanism that regulates brain tumor angiogenesis/vasculogenesis and may provide potential targets for anti-angiogenic therapy in malignant gliomas.

  • Bleul, C.C. et al., 1996, Nature. 382: 829-833.
  • Sapede, D. et al., 2005, Proc. Natl. Acad. Sci. USA. 102: 1714-1718.
  • Delgado, M.B. et al., 2001, Eur. J. Immunol. 31: 699-707.
  • Orimo, A. et al., 2005, Cell. 121: 335-348.
  • Kryczek, I. et al., 2007, Am. J. Physiol. Cell. Physiol. 292: C987-995.
  • Bbalabanian, K. et al., 2005, J. Biol. Chem. 280: 35760-35766.
  • Size / Price
    Каталог: CG90009-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.