After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Резус-фактор C-Reactive Белок/CRP Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus CRP Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_001117250.2
Размер кДНК:675bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) C-reactive protein, pentraxin-related with N terminal Myc tag.
Синоним гена:CRP
Виды:Rhesus
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Резус-фактор C-Reactive Белок/CRP Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Резус-фактор C-Reactive Белок/CRP Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90002-ACGRBS15400
Резус-фактор C-Reactive Белок/CRP Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90002-ACRRBS15400
Резус-фактор C-Reactive Белок/CRP Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90002-CFRBS13340
Резус-фактор C-Reactive Белок/CRP Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90002-CHRBS13340
Резус-фактор C-Reactive Белок/CRP Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90002-CMRBS13340
Резус-фактор C-Reactive Белок/CRP Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90002-CYRBS13340
Резус-фактор C-Reactive Белок/CRP Джин клон кДНК в вектор клонированияCG90002-GRBS5130
Резус-фактор C-Reactive Белок/CRP Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90002-NFRBS13340
Резус-фактор C-Reactive Белок/CRP Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90002-NHRBS13340
Резус-фактор C-Reactive Белок/CRP Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90002-NMRBS13340
Резус-фактор C-Reactive Белок/CRP Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90002-NYRBS13340
Резус-фактор C-Reactive Белок/CRP Джин ORF экспрессии кДНК клона плазмидыCG90002-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

C-reactive protein (CRP) is synthesized by the liver in response to factors released by fat cells. It is a member of the pentraxin family of proteins. The levels of CRP rise in response to inflammation. Human C-reactive protein (CRP) is the classical acute phase reactant, the circulating concentration of which rises rapidly and extensively in a cytokine-mediated response to tissue injury, infection and inflammation. Serum CRP values are routinely measured, empirically, to detect and monitor many human diseases. However, CRP is likely to have important host defence, scavenging and metabolic functions through its capacity for calcium-dependent binding to exogenous and autologous molecules containing phosphocholine (PC) and then activating the classical complement pathway. CRP may also have pathogenic effects and the recent discovery of a prognostic association between increased CRP production and coronary atherothrombotic events is of particular interest.

Ссылки
  • Pepys MB. et al., 2003, J Clin Invest. 111 (12): 1805-12.
  • Thompson D. et al., 1999, Structure. 7(2): 169-77.
  • Size / Price
    Каталог: CG90002-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».