Быстрый заказ

Резус-фактор JAB1/CSN5 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Яванский макак COPS5 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_001260680.1
    Размер кДНК:1005bp
    Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis).
    Синоним гена:COPS5
    Виды:Rhesus
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Резус-фактор JAB1/CSN5 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Резус-фактор JAB1/CSN5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90742-ACGRBS15400
    Резус-фактор JAB1/CSN5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90742-ACRRBS15400
    Резус-фактор JAB1/CSN5 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90742-ANGRBS15400
    Резус-фактор JAB1/CSN5 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90742-ANRRBS15400
    Резус-фактор JAB1/CSN5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90742-CFRBS13340
    Резус-фактор JAB1/CSN5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90742-CHRBS13340
    Резус-фактор JAB1/CSN5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90742-CMRBS13340
    Резус-фактор JAB1/CSN5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90742-CYRBS13340
    Резус-фактор JAB1/CSN5 Джин клон кДНК в вектор клонированияCG90742-GRBS5130
    Резус-фактор JAB1/CSN5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90742-NFRBS13340
    Резус-фактор JAB1/CSN5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90742-NHRBS13340
    Резус-фактор JAB1/CSN5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90742-NMRBS13340
    Резус-фактор JAB1/CSN5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90742-NYRBS13340
    Резус-фактор JAB1/CSN5 Джин ORF экспрессии кДНК клона плазмидыCG90742-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».