After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Резус-фактор JAB1/CSN5 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus COPS5 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001260680.1
Размер кДНК:1005bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis).
Синоним гена:COPS5
Виды:Rhesus
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Резус-фактор JAB1/CSN5 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Резус-фактор JAB1/CSN5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90742-ACGRBS15400
Резус-фактор JAB1/CSN5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90742-ACRRBS15400
Резус-фактор JAB1/CSN5 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90742-ANGRBS15400
Резус-фактор JAB1/CSN5 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90742-ANRRBS15400
Резус-фактор JAB1/CSN5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90742-CFRBS13340
Резус-фактор JAB1/CSN5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90742-CHRBS13340
Резус-фактор JAB1/CSN5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90742-CMRBS13340
Резус-фактор JAB1/CSN5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90742-CYRBS13340
Резус-фактор JAB1/CSN5 Джин клон кДНК в вектор клонированияCG90742-GRBS5130
Резус-фактор JAB1/CSN5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90742-NFRBS13340
Резус-фактор JAB1/CSN5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90742-NHRBS13340
Резус-фактор JAB1/CSN5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90742-NMRBS13340
Резус-фактор JAB1/CSN5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90742-NYRBS13340
Резус-фактор JAB1/CSN5 Джин ORF экспрессии кДНК клона плазмидыCG90742-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90742-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».