After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Яванский макак COMMD7 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus COMMD7 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_005568694.1
Размер кДНК:603bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) COMM domain containing 7.
Синоним гена:COMMD7
Виды:Cynomolgus
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Яванский макак COMMD7 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Яванский макак COMMD7 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90723-ACGRBS15400
Яванский макак COMMD7 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90723-ACRRBS15400
Яванский макак COMMD7 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90723-ANGRBS15400
Яванский макак COMMD7 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90723-ANRRBS15400
Яванский макак COMMD7 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90723-CFRBS13340
Яванский макак COMMD7 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90723-CHRBS13340
Яванский макак COMMD7 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90723-CMRBS13340
Яванский макак COMMD7 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90723-CYRBS13340
Яванский макак COMMD7 Джин клон кДНК в вектор клонированияCG90723-GRBS5130
Яванский макак COMMD7 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90723-NFRBS13340
Яванский макак COMMD7 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90723-NHRBS13340
Яванский макак COMMD7 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90723-NMRBS13340
Яванский макак COMMD7 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90723-NYRBS13340
Яванский макак COMMD7 Джин ORF экспрессии кДНК клона плазмидыCG90723-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90723-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».