After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Яванский макак CHN1 / chimerin 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus CHN1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:AB173631.1
Размер кДНК:1005bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) chimerin 1 with C terminal HA tag.
Синоним гена:CHN1
Виды:Cynomolgus
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Яванский макак CHN1 / chimerin 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Яванский макак CHN1 / chimerin 1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90836-ACGRBS15400
Яванский макак CHN1 / chimerin 1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90836-ACRRBS15400
Яванский макак CHN1 / chimerin 1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90836-ANGRBS15400
Яванский макак CHN1 / chimerin 1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90836-ANRRBS15400
Яванский макак CHN1 / chimerin 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90836-CFRBS13340
Яванский макак CHN1 / chimerin 1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90836-CHRBS13340
Яванский макак CHN1 / chimerin 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90836-CMRBS13340
Яванский макак CHN1 / chimerin 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90836-CYRBS13340
Яванский макак CHN1 / chimerin 1 Джин клон кДНК в вектор клонированияCG90836-GRBS5130
Яванский макак CHN1 / chimerin 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90836-NFRBS13340
Яванский макак CHN1 / chimerin 1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90836-NHRBS13340
Яванский макак CHN1 / chimerin 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90836-NMRBS13340
Яванский макак CHN1 / chimerin 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90836-NYRBS13340
Яванский макак CHN1 / chimerin 1 Джин ORF экспрессии кДНК клона плазмидыCG90836-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

CHN1, also known as chimerin 1, is a TPase-activating protein for ras-related p21-rac and a phorbol ester receptor. It is predominantly expressed in neurons, and plays an important role in neuronal signal-transduction mechanisms. CHN1 is involved in the assembly of neuronal locomotor circuits as a direct effector of EPHA4 in axon guidance. The CHN1 gene provides instructions for making two very similar proteins called α1-chimaerin and α2-chimaerin. These proteins play an important role in the early development of the nervous system. In particular, they help regulate complex chemical signaling pathways during the formation and development of nerve cells (neurons). These proteins help guide the growth of axons and dendrites, which are specialized extensions of neurons that transmit and receive nerve impulses throughout the nervous system.

Ссылки
  • Miyake N. et al, 2010, Am J Med Genet A. 152 (1): 215-7.
  • Miyake N. et al., 2011, Invest Ophthalmol Vis Sci. 52 (9): 6321-8.
  • Volk AE. et al., 2010, Graefes Arch Clin Exp Ophthalmol. 248 (9): 1351-7.
  • Size / Price
    Каталог: CG90836-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».