Быстрый заказ

Резус-фактор CDC42EP4 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus CDC42EP4 Информация о продукте «Клон cDNA»
Размер кДНК:1071bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) CDC42 effector protein (Rho GTPase binding) 4 with C terminal HA tag.
Синоним гена:CDC42EP4
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Резус-фактор CDC42EP4 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Резус-фактор CDC42EP4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90392-ACGRBS15400
Резус-фактор CDC42EP4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90392-ACRRBS15400
Резус-фактор CDC42EP4 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90392-ANGRBS15400
Резус-фактор CDC42EP4 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90392-ANRRBS15400
Резус-фактор CDC42EP4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90392-CFRBS13340
Резус-фактор CDC42EP4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90392-CHRBS13340
Резус-фактор CDC42EP4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90392-CMRBS13340
Резус-фактор CDC42EP4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90392-CYRBS13340
Резус-фактор CDC42EP4 Джин клон кДНК в вектор клонированияCG90392-GRBS5130
Резус-фактор CDC42EP4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90392-NFRBS13340
Резус-фактор CDC42EP4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90392-NHRBS13340
Резус-фактор CDC42EP4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90392-NMRBS13340
Резус-фактор CDC42EP4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90392-NYRBS13340
Резус-фактор CDC42EP4 Джин ORF экспрессии кДНК клона плазмидыCG90392-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90392-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.