CD82 cDNA ORF Clone, Rhesus, C-His tag

Price:
Size:
Number:

CD82 cDNA ORF Clone, Rhesus, C-His tag: General Information

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
801 bp
Description
Full length Clone DNA of Rhesus CD82 molecule with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CD82 Background Information

CD82, also known as KAI-1, structurally belongs to tetraspanin family while categorised as metastasis suppressor gene on functional grounds. KAI1/CD82 is localized on cell membrane and form interactions with other tetraspanins, integrins and chemokines which are respectively responsible for cell migration, adhesion and signalling. Downregulation of CD82 expression is associated with the advanced stages of many human cancers and correlates with the acquisition of metastatic potential. Recent studies suggest that complex mechanisms underlie CD82 loss of function, including altered transcriptional regulation, splice variant production and post-translational protein modifications, and indicate a central role for CD82 in controlling metastasis as a 'molecular facilitator'. The loss of KAI1/CD82 expression in invasive and metastatic cancers is due to a complex, epigenetic mechanism that probably involves transcription factors such as NFkappaB, p53, and beta-catenin. A loss of KAI1 expression is also associated with the advanced stages of many human malignancies and results in the acquisition of invasive and metastatic capabilities by tumour cells. Thus, KAI1/CD82 is regarded as a wide-spectrum tumor metastasis suppressor.
Full Name
CD82 molecule
References
  • Malik FA, et al. (2009) KAI-1/CD82, the molecule and clinical implication in cancer and cancer metastasis. Histol Histopathol. 24(4): 519-30.
  • Liu WM, et al. (2006) KAI1/CD82, a tumor metastasis suppressor. Cancer Lett. 240(2): 183-94.
  • Tonoli H, et al. (2006) CD82 metastasis suppressor gene: a potential target for new therapeutics? Trends Mol Med. 11(12): 563-70.
  • Jackson P, et al. (2005) KAI1 tetraspanin and metastasis suppressor. Int J Biochem Cell Biol. 37(3): 530-4.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait