After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Резус-фактор CD64/Fc gamma RI Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus FCGR1 Информация о продукте «Клон cDNA»
Размер кДНК:1074bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) high affinity immunoglobulin gamma Fc receptor I with N terminal Myc tag.
Синоним гена:FCGR1
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Резус-фактор CD64/Fc gamma RI Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Резус-фактор CD64/Fc gamma RI Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90017-ACGRBS15400
Резус-фактор CD64/Fc gamma RI Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90017-ACRRBS15400
Резус-фактор CD64/Fc gamma RI Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90017-CFRBS13340
Резус-фактор CD64/Fc gamma RI Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90017-CHRBS13340
Резус-фактор CD64/Fc gamma RI Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90017-CMRBS13340
Резус-фактор CD64/Fc gamma RI Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90017-CYRBS13340
Резус-фактор CD64/Fc gamma RI Джин клон кДНК в вектор клонированияCG90017-MRBS5130
Резус-фактор CD64/Fc gamma RI Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90017-NFRBS13340
Резус-фактор CD64/Fc gamma RI Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90017-NHRBS13340
Резус-фактор CD64/Fc gamma RI Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90017-NMRBS13340
Резус-фактор CD64/Fc gamma RI Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90017-NYRBS13340
Резус-фактор CD64/Fc gamma RI Джин ORF экспрессии кДНК клона плазмидыCG90017-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

High affinity immunoglobulin gamma Fc receptor I, also known as FCGR1 and CD64, is an integral membrane glycoprotein and a member of the immunoglobulin superfamily. CD64 is a high affinity receptor for the Fc region of IgG gamma and functions in both innate and adaptive immune responses. Receptors that recognize the Fc portion of IgG function in the regulation of immune response and are divided into three classes designated CD64, CD32, and CD16. CD64 is structurally composed of a signal peptide that allows its transport to the surface of a cell, three extracellular immunoglobulin domains of the C2-type that it uses to bind antibody, a hydrophobic transmembrane domain, and a short cytoplasmic tail. CD64 is constitutively found on only macrophages and monocytes, but treatment of polymorphonuclear leukocytes with cytokines like IFNγ and G-CSF can induce CD64 expression on these cells. The inactivation of the mouse CD64 resulted in a wide range of defects in antibody Fc-dependent functions. Mouse CD64 is an early participant in Fc-dependent cell activation and in the development of immune responses.

Size / Price
Каталог: CG90017-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.