Быстрый заказ

Резус-фактор CD52 / CDW52 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus CD52 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_001108919.2
Размер кДНК:183bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) CD52 molecule with C terminal Flag tag.
Синоним гена:CD52
Виды:Rhesus
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Резус-фактор CD52 / CDW52 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Резус-фактор CD52 / CDW52 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90187-ACGRBS15400
Резус-фактор CD52 / CDW52 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90187-ACRRBS15396
Резус-фактор CD52 / CDW52 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90187-CFRBS13340
Резус-фактор CD52 / CDW52 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90187-CHRBS13343
Резус-фактор CD52 / CDW52 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90187-CMRBS13340
Резус-фактор CD52 / CDW52 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90187-CYRBS13343
Резус-фактор CD52 / CDW52 Джин клон кДНК в вектор клонированияCG90187-GRBS5132
Резус-фактор CD52 / CDW52 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90187-NFRBS13343
Резус-фактор CD52 / CDW52 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90187-NHRBS13343
Резус-фактор CD52 / CDW52 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90187-NMRBS13343
Резус-фактор CD52 / CDW52 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90187-NYRBS13343
Резус-фактор CD52 / CDW52 Джин ORF экспрессии кДНК клона плазмидыCG90187-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

CD52 / CDW52 is a small glycosylphosphatidylinositol (GPI) anchored glycoprotein. It has a mature peptide comprising only 12 amino acids and is abundantly expressed on human lymphocytes. From the clinical point of view this protein is an important target for therapeutic interventions aimed at leukocyte depletion in hematological malignancies and post-transplant immunosuppression. CD52 / CDW52 may play a role in carrying and orienting carbohydrate. It is an unusually good target for complement-mediated cell lysis.

Ссылки
  • Piccaluga PP, et al. (2007) Expression of CD52 in peripheral T-cell lymphoma. Haematologica. 92(4): 566-7.
  • Size / Price
    Каталог: CG90187-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».