Быстрый заказ

Резус-фактор CD5 / Cluster of Differentiation 5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Яванский макак CD5 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_001083880.2
Размер кДНК:1406bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) CD5 molecule with C terminal Flag tag.
Синоним гена:CD5
Виды:Rhesus
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Резус-фактор CD5 / Cluster of Differentiation 5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Резус-фактор CD5 / Cluster of Differentiation 5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90176-ACGRBS15400
Резус-фактор CD5 / Cluster of Differentiation 5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90176-ACRRBS15400
Резус-фактор CD5 / Cluster of Differentiation 5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90176-CFRBS13340
Резус-фактор CD5 / Cluster of Differentiation 5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90176-CHRBS13340
Резус-фактор CD5 / Cluster of Differentiation 5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90176-CMRBS13340
Резус-фактор CD5 / Cluster of Differentiation 5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90176-CYRBS13340
Резус-фактор CD5 / Cluster of Differentiation 5 Джин клон кДНК в вектор клонированияCG90176-GRBS5130
Резус-фактор CD5 / Cluster of Differentiation 5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90176-NFRBS13340
Резус-фактор CD5 / Cluster of Differentiation 5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90176-NHRBS13340
Резус-фактор CD5 / Cluster of Differentiation 5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90176-NMRBS13340
Резус-фактор CD5 / Cluster of Differentiation 5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90176-NYRBS13340
Резус-фактор CD5 / Cluster of Differentiation 5 Джин ORF экспрессии кДНК клона плазмидыCG90176-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD5 is a member of the CD system. CD5 was found to be widely distributed in T-cells and B1 cells which is a subset of IgM-secreting B cells. CD5 also was found expressed in small lymphocytic lymphoma, hairy cell leukaemia and mantle cell lymphoma cells. CD5 serves to weaken the activating stimulus from the BCR so that the B1 cells can only reflect to the very strong stimuli but not the normal tissue proteins.

Ссылки
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters. 134 (2): 104-12.
  • Kirchgessner H, et al. (2001) The transmembrane adaptor protein TRIM regulates T cell receptor (TCR) expression and TCR-mediated signaling via an association with the TCR zeta chain. J Exp Med. 193 (11): 1269-84.
  • Size / Price
    Каталог: CG90176-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».