Быстрый заказ

Яванский макак CD48/Blast-1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus CD48 Информация о продукте «Клон cDNA»
Размер кДНК:723bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) CD48 molecule with N terminal Myc tag.
Синоним гена:CD48
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Яванский макак CD48/Blast-1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Яванский макак CD48/Blast-1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90661-ACGRBS15400
Яванский макак CD48/Blast-1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90661-ACRRBS15400
Яванский макак CD48/Blast-1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90661-CFRBS13340
Яванский макак CD48/Blast-1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90661-CHRBS13340
Яванский макак CD48/Blast-1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90661-CMRBS13340
Яванский макак CD48/Blast-1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90661-CYRBS13340
Яванский макак CD48/Blast-1 Джин клон кДНК в вектор клонированияCG90661-GRBS5130
Яванский макак CD48/Blast-1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90661-NFRBS13340
Яванский макак CD48/Blast-1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90661-NHRBS13340
Яванский макак CD48/Blast-1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90661-NMRBS13340
Яванский макак CD48/Blast-1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90661-NYRBS13340
Яванский макак CD48/Blast-1 Джин ORF экспрессии кДНК клона плазмидыCG90661-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Cluster of Differentiation 48 (CD48), also known as SLAMF2, BCM-1 and BLAST-1, is a GPI-linked protein belonging to the CD2 subfamily of immunoglobulin superfamily molecules. CD2 and 2B4 (CD244) are known ligands for CD48. CD48 protein is expressed on most lineage-committed hematopoietic cells but not on hematopoietic stem cells or multipotent hematopoietic progenitors. CD48 protein performs biological functions in a variety processes including adhesion, pathogen recognition, cellular activation, and cytokine regulation, and emerges as a critical effector molecule in immune responses.

  • Messmer B, et al. (2006) CD48 stimulation by 2B4 (CD244)-expressing targets activates human NK cells. J Immunol. 176(8): 4646-50
  • Milstein O, et al. (2008) Nanoscale increases in CD2-CD48-mediated intermembrane spacing decrease adhesion and reorganize the immunological synapse. J Biol Chem. 283(49): 34414-22.
  • Size / Price
    Каталог: CG90661-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.