CD3G cDNA ORF Clone, Rhesus, C-Myc tag

Price:
Size:
Number:

CD3G cDNA ORF Clone, Rhesus, C-Myc tag: General Information

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
546 bp
Description
Full length Clone DNA of Rhesus CD3g molecule, gamma (CD3-TCR complex) with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CD3G Background Information

CD3G gene encodes CD3-gamma polypeptide, which together with CD3-epsilon, -delta, and -zeta, and the TCR alpha/beta and gamma/delta heterodimers, forms the TCR-CD3 complex. This complex plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. The CD3 gamma chain has long been considered to mediate targeting to lysosomes for degradation. Defects in this gene are associated with T cell immunodeficiency. Further, it has been proposed as one of the important candidate genes for cancer development due to its pivotal roles in TCR signaling pathway.
Full Name
CD3g molecule, gamma (CD3-TCR complex)
References
  • Jiang L, Xu J, Ni J, et al. A Functional Insertion/Deletion Polymorphism in the Proximal Promoter of CD3G Is Associated with Susceptibility for Hepatocellular Carcinoma in Chinese Population. DNA and Cell Biology.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait