After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Резус-фактор CD33/Siglec-3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus CD33 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_001114616.2
Размер кДНК:699bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) CD33 molecule with C terminal Flag tag.
Синоним гена:CD33
Виды:Rhesus
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Резус-фактор CD33/Siglec-3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Резус-фактор CD33/Siglec-3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90183-ACGRBS15400
Резус-фактор CD33/Siglec-3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90183-ACRRBS15400
Резус-фактор CD33/Siglec-3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90183-CFRBS13340
Резус-фактор CD33/Siglec-3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90183-CHRBS13340
Резус-фактор CD33/Siglec-3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90183-CMRBS13340
Резус-фактор CD33/Siglec-3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90183-CYRBS13340
Резус-фактор CD33/Siglec-3 Джин клон кДНК в вектор клонированияCG90183-GRBS5130
Резус-фактор CD33/Siglec-3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90183-NFRBS13340
Резус-фактор CD33/Siglec-3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90183-NHRBS13340
Резус-фактор CD33/Siglec-3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90183-NMRBS13340
Резус-фактор CD33/Siglec-3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90183-NYRBS13340
Резус-фактор CD33/Siglec-3 Джин ORF экспрессии кДНК клона плазмидыCG90183-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Myeloid cell surface antigen CD33 also known as Sialic acid binding Ig-like lectin 3, CD33 antigen or Siglec-3, is a member of the immunoglobulin superfamily and SIGLEC (sialic acid binding Ig-like lectin) family. This Single-pass type I membrane protein contains 1 Ig-like C2-type (immunoglobulin-like) domain and 1 Ig-like V-type (immunoglobulin-like) domain. CD33 /Siglec-3 is a putative adhesion molecule of myelomonocytic-derived cells that mediates sialic-acid dependent binding to cells. CD33 /Siglec-3 preferentially binds to alpha-2,6-linked sialic acid. The sialic acid recognition site may be masked by cis interactions with sialic acids on the same cell surface. In the immune response, may act as an inhibitory receptor upon ligand induced tyrosine phosphorylation by recruiting cytoplasmic phosphatase(s) via their SH2 domain(s) that block signal transduction through dephosphorylation of signaling molecules. CD33/Siglec-3 induces apoptosis in acute myeloid leukemia (in vitro). CD33/Siglec-3 can function as a sialic acid-dependent cell adhesion molecule and that binding can be modulated by endogenous sialoglycoconjugates when CD33 is expressed in a plasma membrane.

Ссылки
  • Simmons D, et al. (1988) Isolation of a cDNA encoding CD33, a differentiation antigen of myeloid progenitor cells. J Immunol. 141(8): 2797-800.
  • Ulyanova T, et al. (1999) The sialoadhesin CD33 is a myeloid-specific inhibitory receptor. Eur J Immunol. 29(11): 3440-9.
  • Freeman SD, et al. (1995) Characterization of CD33 as a new member of the sialoadhesin family of cellular interaction molecules. Blood. 85(8): 2005-12.
  • Size / Price
    Каталог: CG90183-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».