After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Яванский макак CD28/TP44 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus CD28 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001287333.1
Размер кДНК:663bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) CD28 molecule with C terminal Flag tag.
Синоним гена:CD28
Виды:Cynomolgus
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Яванский макак CD28/TP44 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Яванский макак CD28/TP44 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90182-ACGRBS15400
Яванский макак CD28/TP44 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90182-ACRRBS15400
Яванский макак CD28/TP44 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90182-CFRBS13340
Яванский макак CD28/TP44 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90182-CHRBS13340
Яванский макак CD28/TP44 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90182-CMRBS13340
Яванский макак CD28/TP44 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90182-CYRBS13340
Яванский макак CD28/TP44 Джин клон кДНК в вектор клонированияCG90182-GRBS5130
Яванский макак CD28/TP44 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90182-NFRBS13340
Яванский макак CD28/TP44 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90182-NHRBS13340
Яванский макак CD28/TP44 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90182-NMRBS13340
Яванский макак CD28/TP44 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90182-NYRBS13340
Яванский макак CD28/TP44 Джин ORF экспрессии кДНК клона плазмидыCG90182-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

CD28 (Cluster of Differentiation 28) is a disulphide-bonded glycoprotein belonging to the immunoglobulin (Ig) superfamily, and structurally consists of a single Ig V-like extracellular domain, a transmembrane domain and an intracellular domain. Mouse CD28 is constitutively expressed on the surface of all murine T cells and on developing thymocytes as disulfide-linked homodimers or as monomers. CD28 can binds the B7-1 and B7-2 ligand, and together perform important functions in the T and B cell response pathways. B7/CD28 family members, which can augment or antagonize T-cell receptor signaling, in the regulation of central and peripheral T-cell tolerance. CD28 is thus involved in T-cell activation, the induction of cell proliferation and cytokine production and promotion of T-cell survival.

Ссылки
  • Keir ME, et al. (2005) The B7/CD28 costimulatory family in autoimmunity. Immunol Rev. 204: 128-43.
  • Sansom DM, et al. (2006) The role of CD28 and cytotoxic T-lymphocyte antigen-4 (CTLA-4) in regulatory T-cell biology. Immunol Rev. 212: 131-48.
  • Bjrgo E, et al. (2010) Novel mechanism of signaling by CD28. Immunol Lett. 129(1): 1-6.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».