CD27 cDNA ORF Clone, Rhesus, C-Myc tag

Price:
Size:
Number:

CD27 cDNA ORF Clone, Rhesus, C-Myc tag: General Information

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
783 bp
Description
Full length Clone DNA of Rhesus CD27 antigen-like with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CD27 Background Information

CD27, also known as TNFRSF7, is a member of the TNF-receptor superfamily limited to cells of the lymphoid lineage, and exists as both a dimeric glycoprotein on the cell surface and as a soluble protein in serum. As a type I transmembrane glycoprotein of about 55 kDa existing as disulfide-linked homodimer, CD27 has been shown to play roles in lymphoid proliferation, differentiation, and apoptosis.It has important role in generation of T cell immunity, and is an apparently robust marker for normal memory B cells. It is a T and B cell co-stimulatory molecule, the activity of CD27 is governed by its TNF-like ligand CD7 on lymphocytes and dendritic cells. The CD27-CD7 interaction is required for Th1 generation responses to differentiation signals and long-term maintenance of T cell immunity, and meanwhile, plays a key role in regulating B-cell differentiation, activation and immunoglobulin synthesis.
Full Name
CD27 molecule
Research Areas
References
  • Drner T, et al. (2004) Correlation of circulating CD27 high plasma cells and disease activity in systemic lupus erythematosus. Lupus. 13(5): 283-9.
  • Sahota SS, et al. (2009) CD27 in defining memory B-cell origins in Waldenstrm's macroglobulinemia. Clin Lymphoma Myeloma. 9(1): 33-5.
  • Jiang J, et al. (2010) Reduced CD27 expression on antigen-specific CD4+ T cells correlates with persistent active tuberculosis. J Clin Immunol. 30(4): 566-73.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait