Быстрый заказ

Text Size:AAA

Яванский макак CD226/DNAM-1/PTA1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus CD226 Информация о продукте «Клон cDNA»
Размер кДНК:1011bp
Описание кДНК:Full length Clone DNA of Macaca mulatta CD226 molecule with C terminal Flag tag.
Синоним гена:PTA1, CD226
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Яванский макак CD226/DNAM-1/PTA1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Яванский макак CD226/DNAM-1/PTA1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90181-ACGRBS15400
Яванский макак CD226/DNAM-1/PTA1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90181-ACRRBS15400
Яванский макак CD226/DNAM-1/PTA1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90181-CFRBS13340
Яванский макак CD226/DNAM-1/PTA1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90181-CHRBS13340
Яванский макак CD226/DNAM-1/PTA1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90181-CMRBS13340
Яванский макак CD226/DNAM-1/PTA1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90181-CYRBS13340
Яванский макак CD226/DNAM-1/PTA1 Джин клон кДНК в вектор клонированияCG90181-GRBS5130
Яванский макак CD226/DNAM-1/PTA1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90181-NFRBS13340
Яванский макак CD226/DNAM-1/PTA1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90181-NHRBS13340
Яванский макак CD226/DNAM-1/PTA1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90181-NMRBS13340
Яванский макак CD226/DNAM-1/PTA1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90181-NYRBS13340
Яванский макак CD226/DNAM-1/PTA1 Джин ORF экспрессии кДНК клона плазмидыCG90181-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD226, also known as PTA1 or DNAM-1, is a member of the immunoglobulin superfamily containing 2 Ig-like domains of the V-set. High rate of CD226 (Cluster of Differentiation 226) is found on the surface of natural killer cells, platelets, monocytes and a subset of T cells. CD226 have binding sites with CD112 and CD155 and mediate cellular adhesion to other cells containing its ligands.

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Size / Price
    Каталог: CG90181-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.