Быстрый заказ

Text Size:AAA

Резус-фактор CD1B Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus CD1B Информация о продукте «Клон cDNA»
Размер кДНК:1002bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) CD1b molecule with C terminal Flag tag.
Синоним гена:CD1B
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Резус-фактор CD1B Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Резус-фактор CD1B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90173-ACGRBS15400
Резус-фактор CD1B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90173-ACRRBS15400
Резус-фактор CD1B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90173-CFRBS13340
Резус-фактор CD1B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90173-CHRBS13340
Резус-фактор CD1B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90173-CMRBS13340
Резус-фактор CD1B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90173-CYRBS13340
Резус-фактор CD1B Джин клон кДНК в вектор клонированияCG90173-GRBS5130
Резус-фактор CD1B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90173-NFRBS13340
Резус-фактор CD1B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90173-NHRBS13340
Резус-фактор CD1B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90173-NMRBS13340
Резус-фактор CD1B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90173-NYRBS13340
Резус-фактор CD1B Джин ORF экспрессии кДНК клона плазмидыCG90173-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

CD1B contains 1 Ig-like (immunoglobulin-like) domain and belongs to the CD1 family. CD1 family members are transmembrane glycoproteins, which are structurally related to the major histocompatibility complex (MHC) proteins and form heterodimers with beta-2-microglobulin. During protein synthesis and maturation, they bind endogenous lipids that are replaced by lipid or glycolipid antigens when the proteins are internalized and pass through endosomes, before trafficking back to the cell surface. CD1B localizes to late endosomes and lysosomes via a tyrosine-based motif in the cytoplasmic tail, and requires vesicular acidification to bind lipid antigens.. It is expressed on cortical thymocytes, epidermal Langerhans cells, dendritic cells, on certain T-cell leukemias, and in various other tissues. CD1B is an antigen-presenting protein that binds self and non-self lipid and glycolipid antigens and presents them to T-cell receptors on natural killer T-cells.

  • Coventry B, et al. (2004) CD1a in human cancers: a new role for an old molecule. Trends Immunol. 25 (5):242-8.
  • Martin LH, et al. (1988) Structure and expression of the human thymocyte antigens CD1a, CD1b, and CD1c. Proc Natl Acad Sci. 84(24):9189-93.
  • Aruffo A, et al. (1989) Expression of cDNA clones encoding the thymocyte antigens CD1a, b, c demonstrates a hierarchy of exclusion in fibroblasts. J Immunol. 143(5):1723-30.
  • Longley J, et al. (1989) Molecular cloning of CD1a (T6), a human epidermal dendritic cell marker related to class I MHC molecules. J Invest Dermatol. 92(4):628-31.
  • Size / Price
    Каталог: CG90173-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.