Быстрый заказ

Text Size:AAA

Резус-фактор CD155/PVR Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus PVR Информация о продукте «Клон cDNA»
Размер кДНК:675bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) poliovirus receptor with N terminal Myc tag.
Синоним гена:PVR
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Резус-фактор CD155/PVR Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Резус-фактор CD155/PVR Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90005-ACGRBS15400
Резус-фактор CD155/PVR Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90005-ACRRBS15400
Резус-фактор CD155/PVR Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90005-CFRBS13340
Резус-фактор CD155/PVR Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90005-CHRBS13340
Резус-фактор CD155/PVR Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90005-CMRBS13340
Резус-фактор CD155/PVR Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90005-CYRBS13340
Резус-фактор CD155/PVR Джин клон кДНК в вектор клонированияCG90005-GRBS5130
Резус-фактор CD155/PVR Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90005-NFRBS13340
Резус-фактор CD155/PVR Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90005-NHRBS13340
Резус-фактор CD155/PVR Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90005-NMRBS13340
Резус-фактор CD155/PVR Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90005-NYRBS13340
Резус-фактор CD155/PVR Джин ORF экспрессии кДНК клона плазмидыCG90005-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

CD155, commonly known as PVR (poliovirus receptor) and Necl-5 (nectin-like molecule-5), is a type I transmembrane single-span glycoprotein, and belongs to the nectins and nectin-like (Necl) subfamily. CD155 was originally identified based on its ability to mediate the cell attachment and entry of poliovirus (PV), an etiologic agent of the central nervous system disease poliomyelitis. The normal cellular function is in the establishment of intercellular adherens junctions between epithelial cells. CD155 may assist in an efficient humoral immune response generated within the intestinal immune system. It has been demonstrated that CD155 can be recognized and bond by DNAM-1 and CD96 which promote the adhension, migration and NK-cell killing, and thus efficiently prime cell-mediated tumor-specific immunity.

  • Freistadt MS, et al. (2000) Hematopoietic cells from CD155-transgenic mice express CD155 and support poliovirus replication ex vivo. Microb Pathog. 29(4): 203-12.
  • Sato T, et al. (2004) Involvement of heterophilic trans-interaction of Necl-5/Tage4/PVR/CD155 with nectin-3 in formation of nectin- and cadherin-based adherens junctions. Genes Cells. 9(9): 791-9.
  • Kakunaga S, et al. (2004) Enhancement of serum- and platelet-derived growth factor-induced cell proliferation by Necl-5/Tage4/poliovirus receptor/CD155 through the Ras-Raf-MEK-ERK signaling. J Biol Chem. 279(35): 36419-25.
  • Sato T, et al. (2005) Common signaling pathway is used by the trans-interaction of Necl-5/Tage4/PVR/CD155 and nectin, and of nectin and nectin during the formation of cell-cell adhesion. Cancer Sci. 96(9): 578-89.
  • Minami Y, et al. (2007) Involvement of up-regulated Necl-5/Tage4/PVR/CD155 in the loss of contact inhibition in transformed NIH3T3 cells. Biochem Biophys Res Commun. 352(4): 856-60.
  • Size / Price
    Каталог: CG90005-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.