After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Яванский макак CD151 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus CD151 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_005576813.1
Размер кДНК:762bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) CD151 molecule (Raph blood group).
Синоним гена:CD151
Виды:Cynomolgus
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Яванский макак CD151 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Яванский макак CD151 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90749-ACGRBS15400
Яванский макак CD151 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90749-ACRRBS15400
Яванский макак CD151 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90749-CFRBS13340
Яванский макак CD151 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90749-CHRBS13340
Яванский макак CD151 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90749-CMRBS13340
Яванский макак CD151 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90749-CYRBS13340
Яванский макак CD151 Джин клон кДНК в вектор клонированияCG90749-GRBS5130
Яванский макак CD151 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90749-NFRBS13340
Яванский макак CD151 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90749-NHRBS13340
Яванский макак CD151 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90749-NMRBS13340
Яванский макак CD151 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90749-NYRBS13340
Яванский макак CD151 Джин ORF экспрессии кДНК клона плазмидыCG90749-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90749-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».