Быстрый заказ

Text Size:AAA

Резус-фактор CD14 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus CD14 Информация о продукте «Клон cDNA»
Размер кДНК:1128bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) CD14 molecule with C terminal Flag tag.
Синоним гена:CD14
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Резус-фактор CD14 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Резус-фактор CD14 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90174-ACGRBS15400
Резус-фактор CD14 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90174-ACRRBS15396
Резус-фактор CD14 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90174-CFRBS13340
Резус-фактор CD14 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90174-CHRBS13343
Резус-фактор CD14 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90174-CMRBS13340
Резус-фактор CD14 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90174-CYRBS13343
Резус-фактор CD14 Джин клон кДНК в вектор клонированияCG90174-GRBS5130
Резус-фактор CD14 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90174-NFRBS13343
Резус-фактор CD14 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90174-NHRBS13340
Резус-фактор CD14 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90174-NMRBS13340
Резус-фактор CD14 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90174-NYRBS13343
Резус-фактор CD14 Джин ORF экспрессии кДНК клона плазмидыCG90174-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. Cluster of differentiation 14 (CD14) is a member of the CD system. It takes its name from its inclusion in the CD molecule surface marker proteins. CD14 exists in two forms: a form anchored into the membrane or a soluble form. CD14 was found expressed in macrophages, neutrophil granulocyte and dendritic cells. The major function is serve as a co-receptor (along with TLR4 and MD-2) for the bacterial lipopolysaccharide (LPS) and other pathogen-associated molecular patterns.

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • SD Wright, et al. (1990) CD14, a receptor for complexes of lipopolysaccharide (LPS) and LPS binding protein. Science. 249 (4975): 1431-3.
  • Size / Price
    Каталог: CG90174-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.