After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Яванский макак CoCoA/CALCOCO1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus CALCOCO1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_005571041.1
Размер кДНК:2073bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) calcium binding and coiled-coil domain 1 with C terminal Myc tag.
Синоним гена:CALCOCO1
Виды:Cynomolgus
переносчик:pCMV3-C-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Яванский макак CoCoA/CALCOCO1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Яванский макак CoCoA/CALCOCO1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90426-ACGRBS16760
Яванский макак CoCoA/CALCOCO1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90426-ACRRBS16760
Яванский макак CoCoA/CALCOCO1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90426-ANGRBS16760
Яванский макак CoCoA/CALCOCO1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90426-ANRRBS16760
Яванский макак CoCoA/CALCOCO1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90426-CFRBS14710
Яванский макак CoCoA/CALCOCO1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90426-CHRBS14710
Яванский макак CoCoA/CALCOCO1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90426-CMRBS14710
Яванский макак CoCoA/CALCOCO1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90426-CYRBS14710
Яванский макак CoCoA/CALCOCO1 Джин клон кДНК в вектор клонированияCG90426-GRBS5130
Яванский макак CoCoA/CALCOCO1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90426-NFRBS14710
Яванский макак CoCoA/CALCOCO1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90426-NHRBS14710
Яванский макак CoCoA/CALCOCO1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90426-NMRBS14710
Яванский макак CoCoA/CALCOCO1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90426-NYRBS14710
Яванский макак CoCoA/CALCOCO1 Джин ORF экспрессии кДНК клона плазмидыCG90426-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90426-CM
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».