After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Резус-фактор Siah-interacting Белок/CacyBP Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus CACYBP Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001266661.1
Размер кДНК:687bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) calcyclin binding protein with N terminal His tag.
Синоним гена:CACYBP
Виды:Rhesus
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Резус-фактор Siah-interacting Белок/CacyBP Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Резус-фактор Siah-interacting Белок/CacyBP Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90601-ACGRBS15396
Резус-фактор Siah-interacting Белок/CacyBP Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90601-ACRRBS15396
Резус-фактор Siah-interacting Белок/CacyBP Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90601-ANGRBS15396
Резус-фактор Siah-interacting Белок/CacyBP Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90601-ANRRBS15396
Резус-фактор Siah-interacting Белок/CacyBP Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90601-CFRBS13343
Резус-фактор Siah-interacting Белок/CacyBP Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90601-CHRBS13343
Резус-фактор Siah-interacting Белок/CacyBP Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90601-CMRBS13343
Резус-фактор Siah-interacting Белок/CacyBP Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90601-CYRBS13343
Резус-фактор Siah-interacting Белок/CacyBP Джин клон кДНК в вектор клонированияCG90601-GRBS5132
Резус-фактор Siah-interacting Белок/CacyBP Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90601-NFRBS13343
Резус-фактор Siah-interacting Белок/CacyBP Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90601-NHRBS13343
Резус-фактор Siah-interacting Белок/CacyBP Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90601-NMRBS13343
Резус-фактор Siah-interacting Белок/CacyBP Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90601-NYRBS13343
Резус-фактор Siah-interacting Белок/CacyBP Джин ORF экспрессии кДНК клона плазмидыCG90601-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90601-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».