After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Резус-фактор C20H16orf45 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus C20H16orf45 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001194421.1
Размер кДНК:615bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) chromosome 16 open reading frame 45 with N terminal HA tag.
Синоним гена:C16orf45
Виды:Rhesus
переносчик:pCMV3-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Резус-фактор C20H16orf45 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Резус-фактор C20H16orf45 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90430-ACGRBS15400
Резус-фактор C20H16orf45 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90430-ACRRBS15400
Резус-фактор C20H16orf45 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90430-ANGRBS15400
Резус-фактор C20H16orf45 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90430-ANRRBS15400
Резус-фактор C20H16orf45 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90430-CFRBS13340
Резус-фактор C20H16orf45 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90430-CHRBS13340
Резус-фактор C20H16orf45 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90430-CMRBS13340
Резус-фактор C20H16orf45 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90430-CYRBS13340
Резус-фактор C20H16orf45 Джин клон кДНК в вектор клонированияCG90430-GRBS5130
Резус-фактор C20H16orf45 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90430-NFRBS13340
Резус-фактор C20H16orf45 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90430-NHRBS13340
Резус-фактор C20H16orf45 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90430-NMRBS13340
Резус-фактор C20H16orf45 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90430-NYRBS13340
Резус-фактор C20H16orf45 Джин ORF экспрессии кДНК клона плазмидыCG90430-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».