Быстрый заказ

Резус-фактор C20H16orf45 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Яванский макак C20H16orf45 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_001194421.1
    Размер кДНК:615bp
    Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) chromosome 16 open reading frame 45 with C terminal Myc tag.
    Синоним гена:C16orf45
    Виды:Rhesus
    переносчик:pCMV3-C-Myc
    Plasmid:
    Участок рестрикции:
    Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Резус-фактор C20H16orf45 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
    Резус-фактор C20H16orf45 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90430-ACGRBS22240
    Резус-фактор C20H16orf45 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90430-ACRRBS22240
    Резус-фактор C20H16orf45 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90430-ANGRBS22240
    Резус-фактор C20H16orf45 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90430-ANRRBS22240
    Резус-фактор C20H16orf45 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90430-CFRBS20190
    Резус-фактор C20H16orf45 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90430-CHRBS20190
    Резус-фактор C20H16orf45 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90430-CMRBS20190
    Резус-фактор C20H16orf45 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90430-CYRBS20190
    Резус-фактор C20H16orf45 Джин клон кДНК в вектор клонированияCG90430-GRBS5130
    Резус-фактор C20H16orf45 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90430-NFRBS20190
    Резус-фактор C20H16orf45 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90430-NHRBS20190
    Резус-фактор C20H16orf45 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90430-NMRBS20190
    Резус-фактор C20H16orf45 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90430-NYRBS20190
    Резус-фактор C20H16orf45 Джин ORF экспрессии кДНК клона плазмидыCG90430-UTRBS20190
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: CG90430-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».