BMP5 cDNA ORF Clone, Rhesus, C-Myc tag

Price:
Size:
Number:

BMP5 cDNA ORF Clone, Rhesus, C-Myc tag: General Information

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1365 bp
Description
Full length Clone DNA of Rhesus bone morphogenetic protein 5 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

BMP5 Background Information

Bone Morphogenetic Protein 5 (BMP-5) is a member of the structurally and functionally related bone morphogenetic proteins (BMPs) which constitute a novel subfamily of the transforming growth factor β (TGF-β) superfamily. In agreement with a possible role in the control of cell death, BMP-5 exhibited a regulated pattern of expression in the interdigital tissue. Transcripts of BMP-5 and BMP-5 protein were abundant within the cytoplasm of the fragmenting apoptotic interdigital cells in a way suggesting that delivery of BMPs into the tissue is potentiated during apoptosis. Gain-of-function experiments demonstrated that BMP-5 has the same effect as other interdigital BMPs inducing apoptosis in the undifferentiated mesoderm and growth in the prechondrogenic mesenchyme. BMP-5 is a member of the 6A subgroup of BMPs, other members of which have been shown to stimulate dendritic growth in central and peripheral neurons. The signaling pathway that mediates the dendrite-promoting activity of BMP-5 may involve binding to BMPR-IA and activation of Smad-1, and relative levels of BMP antagonists such as noggin and follistatin may modulate BMP-5 signaling. Since BMP-5 is expressed at relatively high levels not only in the developing but also the adult nervous system, these findings suggest the possibility that BMP-5 regulates dendritic morphology not only in the developing, but also the adult nervous system. BMP-5 may play important roles not only in myocardial differentiation, but also in the formation and maintenance of endocardial cushion tissue. Additionally, high expression level of BMP-5 has been detected in certain tumors of mesenchymal origin.
Full Name
bone morphogenetic protein 5
References
  • Yamagishi T, et al. (2001) Expression of bone morphogenetic protein-5 gene during chick heart development: possible roles in valvuloseptal endocardial cushion formation. Anat Rec. 264(4): 313-6.
  • Beck HN, et al. (2001) Bone morphogenetic protein-5 (BMP-5) promotes dendritic growth in cultured sympathetic neurons. BMC Neurosci. 2:12.
  • Zuzarte-Lus V, et al. (2004) A new role for BMP5 during limb development acting through the synergic activation of Smad and MAPK pathways. Dev Biol. 272(1): 39-52.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait