After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Резус-фактор BMP-5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus BMP5 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_001109809.1
Размер кДНК:1365bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) bone morphogenetic protein 5 with C terminal Myc tag.
Синоним гена:BMP5
Виды:Rhesus
переносчик:pCMV3-C-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Резус-фактор BMP-5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Резус-фактор BMP-5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90053-ACGRBS15396
Резус-фактор BMP-5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90053-ACRRBS15396
Резус-фактор BMP-5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90053-CFRBS13343
Резус-фактор BMP-5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90053-CHRBS13343
Резус-фактор BMP-5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90053-CMRBS13343
Резус-фактор BMP-5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90053-CYRBS13343
Резус-фактор BMP-5 Джин клон кДНК в вектор клонированияCG90053-GRBS5132
Резус-фактор BMP-5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90053-NFRBS13343
Резус-фактор BMP-5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90053-NHRBS13343
Резус-фактор BMP-5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90053-NMRBS13343
Резус-фактор BMP-5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90053-NYRBS13343
Резус-фактор BMP-5 Джин ORF экспрессии кДНК клона плазмидыCG90053-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Bone Morphogenetic Protein 5 (BMP-5) is a member of the structurally and functionally related bone morphogenetic proteins (BMPs) which constitute a novel subfamily of the transforming growth factor β (TGF-β) superfamily. In agreement with a possible role in the control of cell death, BMP-5 exhibited a regulated pattern of expression in the interdigital tissue. Transcripts of BMP-5 and BMP-5 protein were abundant within the cytoplasm of the fragmenting apoptotic interdigital cells in a way suggesting that delivery of BMPs into the tissue is potentiated during apoptosis. Gain-of-function experiments demonstrated that BMP-5 has the same effect as other interdigital BMPs inducing apoptosis in the undifferentiated mesoderm and growth in the prechondrogenic mesenchyme. BMP-5 is a member of the 60A subgroup of BMPs, other members of which have been shown to stimulate dendritic growth in central and peripheral neurons. The signaling pathway that mediates the dendrite-promoting activity of BMP-5 may involve binding to BMPR-IA and activation of Smad-1, and relative levels of BMP antagonists such as noggin and follistatin may modulate BMP-5 signaling. Since BMP-5 is expressed at relatively high levels not only in the developing but also the adult nervous system, these findings suggest the possibility that BMP-5 regulates dendritic morphology not only in the developing, but also the adult nervous system. BMP-5 may play important roles not only in myocardial differentiation, but also in the formation and maintenance of endocardial cushion tissue. Additionally, high expression level of BMP-5 has been detected in certain tumors of mesenchymal origin.

Ссылки
  • Yamagishi T, et al. (2001) Expression of bone morphogenetic protein-5 gene during chick heart development: possible roles in valvuloseptal endocardial cushion formation. Anat Rec. 264(4): 313-6.
  • Beck HN, et al. (2001) Bone morphogenetic protein-5 (BMP-5) promotes dendritic growth in cultured sympathetic neurons. BMC Neurosci. 2:12.
  • Zuzarte-Lus V, et al. (2004) A new role for BMP5 during limb development acting through the synergic activation of Smad and MAPK pathways. Dev Biol. 272(1): 39-52.
  • Size / Price
    Каталог: CG90053-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».