After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Резус-фактор BMP-2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus BMP2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_001115987.1
Размер кДНК:1191bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) bone morphogenetic protein 2 with C terminal Myc tag.
Синоним гена:BMP2
Виды:Rhesus
переносчик:pCMV3-C-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Резус-фактор BMP-2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Резус-фактор BMP-2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90041-ACGRBS15396
Резус-фактор BMP-2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90041-ACRRBS15400
Резус-фактор BMP-2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90041-CFRBS13340
Резус-фактор BMP-2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90041-CHRBS13340
Резус-фактор BMP-2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90041-CMRBS13343
Резус-фактор BMP-2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90041-CYRBS13340
Резус-фактор BMP-2 Джин клон кДНК в вектор клонированияCG90041-GRBS5130
Резус-фактор BMP-2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90041-NFRBS13340
Резус-фактор BMP-2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90041-NHRBS13343
Резус-фактор BMP-2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90041-NMRBS13343
Резус-фактор BMP-2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90041-NYRBS13340
Резус-фактор BMP-2 Джин ORF экспрессии кДНК клона плазмидыCG90041-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

BMP-2 protein, like other bone morphogenetic proteins, plays an important role in the development of bone and cartilage. BMP-2 protein is involved in the hedgehog pathway, TGF beta signaling pathway, and cytokine-cytokine receptor interaction. BMP-2 and BMP-7 are osteogenic BMPs that have been demonstrated to potently induce osteoblast differentiation in a variety of cell types. BMP-2, BMP-4 and BMP-7 are known to be of major importance in bone formation and repair. In cancerous tissues BMP-2 protein may play an important role in the progression of glioma.

Ссылки
  • Jiao X, et al. (2007) Heparan sulfate proteoglycans (HSPGs) modulate BMP-2 osteogenic bioactivity in C2C12 cells. J Biol Chem. 282(2):1080-6.
  • Michon F, et al. (2008) BMP-2 and BMP-7 play antagonistic roles in feather induction. Development 135 (16):2797-805.
  • Size / Price
    Каталог: CG90041-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».